CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Napoleonaea Vogelii

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAACAACCAGTGAACTTGTTCTTGCCCAGGGGGCGAGTGACGGCGTTGTCCCTTCACCCGTTCCCCCTGAACCCGGGGGCATGCCCGTTGCCTCTAGGGGCTTTGGGCATGTTCACGGCCTAACAACSAACCCCGGCGCGAATTGCGCCAAGGAAATGAAAAGAGATAGCGTGCCCCTAAGGCCTCGTTCGCGATGCGCCTAGGGGCGAAGGCTTCTTATCGAAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCTTGTATTGCGTCGCCCCCTGCACCATGCCCCTCTTAGGGGGGCACTGCTCGGGGGCGGACACTGGCCCCCCGTGCGCTCACGCCTACGGTCGGCCTAAAAACGAGTCCCCGTCGACAGATGTCACGACGAGTGGTGGCTGACATAACGTTCGCGTCCCGTCGTGCTTGTTCCCGTCGACAAGGGTGATCTCCAATGACCCTAAAGCACCGCGTAGCGACGGTTGCCTCGAT

Click for details-----ITS1

Click for details-----ITS2

TATTGCGTCGCCCCCTGCACCATGCCCCTCTTAGGGGGGCACTGCTCGGGGGCGGACACTGGCCCCCCGTGCGCTCACGCCTACGGTCGGCCTAAAAACGAGTCCCCGTCGACAGATGTCACGACGAGTGGTGGCTGACATAACGTTCGCGTCCCGTCGTGCTTGTTCCCGTCGACAAGGGTGATCTCCAATGACCCTAAAGCACCGCGTAGCGACGGTTGCCTCGAT

Taxonomic Information

Plant ID: NPO13641
Plant Latin Name: Napoleonaea Vogelii
Taxonomy Genus: Napoleonaea
Taxonomy Family: Lecythidaceae

Plant External Links:

NCBI TaxonomyDB: 79577
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

23 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

16 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC80710

Ingredient ID: NPC78263

Ingredient ID: NPC46436

Ingredient ID: NPC35446

Ingredient ID: NPC304543

Ingredient ID: NPC294409

Ingredient ID: NPC284264

Ingredient ID: NPC279668

Ingredient ID: NPC270456

Ingredient ID: NPC262359

Ingredient ID: NPC245889

Ingredient ID: NPC243728

Ingredient ID: NPC233752

Ingredient ID: NPC228024

Ingredient ID: NPC226333

Ingredient ID: NPC225434

Ingredient ID: NPC22152

Ingredient ID: NPC192638

Ingredient ID: NPC182428

Ingredient ID: NPC181465

Ingredient ID: NPC143427

Ingredient ID: NPC135350

Ingredient ID: NPC112368

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 2	CYP2C9	Cytochrome P450 2C9	P11712	CHEMBL3397
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CA7,CYP2C9,CES1,MAOB
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,CYP19A1,CA12,CYP19A1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,CYP2C9,CA7
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,CYP2C9,CA7
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,CA7,CYP19A1
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CYP2C9,CA12
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA12,CYP19A1
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA7,CYP19A1
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12,CYP19A1
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CA12,MAOB
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CYP2C9,CYP19A1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA12,CA7
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12,CA7
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,CYP19A1
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,CYP2C9
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA12
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	MAOB
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	MAOB
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	CYP19A1
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	MAOB
Nausea/vomiting Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD90	MAOB
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Skin tag/polyp Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK71	MAOB
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	MAOB
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	MAOB
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	MAOB
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	MAOB
Skin cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30-2C37	MAOB
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	MAOB
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	MAOB
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	CYP19A1
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	MAOB
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	MAOB
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	CES1
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1
Primary psychotic disorder manifestation Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A25	MAOB
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	CYP2C9
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CYP19A1
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	CYP19A1
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CYP2C9
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CYP2C9
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP2C9
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	CYP19A1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CYP2C9
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Napoleonaea Vogelii

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

23 All known Ingredients in Total

16 Ingredients with Acceptable Bioavailablity

12 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Hepatocellular carcinoma of liver

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of bronchus or lung

Malignant neoplasms of adrenal gland

Bacterial infection

Breast cancer

Carcinosarcoma of uterus

Hepatoblastoma

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Mesothelioma of pleura

Malignant neoplasms of thyroid gland, unspecified

Glioblastoma of brain

Germ cell tumour of testis

Solid tumour/cancer

Synthesis disorder

Alzheimer disease

Seborrhoeic dermatitis

Pulmonary hypertension

Endometriosis

Acquired hypomelanotic disorder

Nausea/vomiting

Peroxisomal disease

Oesophagitis

Skin tag/polyp

Hyper-lipoproteinaemia

Prostate cancer

Depression

Malaria

Migraine

Skin cancer

Muscular dystrophy

General pain disorder

Cushing syndrome

Parkinsonism

Dementia

Chronic arterial occlusive disease

Neuropathy

Primary psychotic disorder manifestation

Serous cystadenoma,borderline malignancy of ovary

Myelodysplastic syndromes, unspecified

Osteoarthritis, unspecified

Adenocarcinoma of stomach

Atrial fibrillation

West Nile virus infection

Other specified malignant neoplasms of bronchus or lung

Urothelial carcinoma of bladder

Cytomegaloviral disease

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Malignant neoplasms of thymus

Invasive carcinoma of breast

Renal cell carcinoma, chromophobe type

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities