• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Thalictrum Foliolosum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGAAGGATCATTGTCGAAACCTGCCTAGCAGAACGACCCGTGGACACGTCAAAACAACTATGATGGGGACCGGAGAGGGGCGCGAGCCCCCGACCGACCCCTTCGCCCGTTCCTCGGTGCTGGCTGCATGCGGCCGACCGTGGTCGGGCACAAACAAAAACCCGGCGCAACTAGCGTCAAGGAAATCTTAGCGGAAACAAGGAGGAGCCTCGCTTGCGGGGTGACACCGTGAATCCGATATTTGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGTCGAGGGCACGTCTGCCTGGGCGTCACGCACAGCGTCGCCCCCAACCACACTTGTTGTGGAAGGGGAGCGGAGATTGGCCCCCCGAGCCCTATCAGGCACGGTCGGCACAAATGCCTGTCCCTGGCAGCGGTCGCCGCGGTCAAGTGGTGGCTTCAAATACCATTTCGGTGACCGGTTGGCGCTGCAGCCCTAGTTGGGACAGAATTGACCCGCAGAGGCCGTTCCGACGGCGTTTCACC

Click for details-----ITS1

NA

Click for details-----ITS2

ACAGCGTCGCCCCCAACCACACTTGTTGTGGAAGGGGAGCGGAGATTGGCCCCCCGAGCCCTATCAGGCACGGTCGGCACAAATGCCTGTCCCTGGCAGCGGTCGCCGCGGTCAAGTGGTGGCTTCAAATACCATTTCGGTGACCGGTTGGCGCTGCAGCCCTAGTTGGGACAGAATTGACCCGCAGAGGCCGTTCCGACGGCGTTTCACC
Taxonomic Information

Plant ID: NPO13637
Plant Latin Name: Thalictrum Foliolosum
Taxonomy Genus: Thalictrum
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 1277777
Plant-of-the-World-Online: 714441-1

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM; Ayurveda; Siddha


Medicinal Functions:

Antiperiodic; Diuretic; Febrifuge; Ophthalmic; Purgative; Salve; Stomachic; Tonic

Geographical Distribution

India; Nepal; China; Myanmar; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

52 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


23 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC91382

Ingredient ID: NPC88864

Ingredient ID: NPC87364

Ingredient ID: NPC86469

Ingredient ID: NPC81218

Ingredient ID: NPC79549

Ingredient ID: NPC77572

Ingredient ID: NPC73199

Ingredient ID: NPC67978

Ingredient ID: NPC59567

Ingredient ID: NPC49075

Ingredient ID: NPC46470

Ingredient ID: NPC428

Ingredient ID: NPC326451

Ingredient ID: NPC32572

Ingredient ID: NPC317145

Ingredient ID: NPC303581

Ingredient ID: NPC291352

Ingredient ID: NPC281457

Ingredient ID: NPC2706

Ingredient ID: NPC263883

Ingredient ID: NPC251735

Ingredient ID: NPC248109

Ingredient ID: NPC23367

Ingredient ID: NPC229373

Ingredient ID: NPC220268

Ingredient ID: NPC215124

Ingredient ID: NPC207786

Ingredient ID: NPC202605

Ingredient ID: NPC200555

Ingredient ID: NPC199402

Ingredient ID: NPC183485

Ingredient ID: NPC171409

Ingredient ID: NPC16452

Ingredient ID: NPC164203

Ingredient ID: NPC154351

Ingredient ID: NPC153319

Ingredient ID: NPC15025

Ingredient ID: NPC150006

Ingredient ID: NPC147390

Ingredient ID: NPC13826

Ingredient ID: NPC130704

Ingredient ID: NPC121400

Ingredient ID: NPC12053

Ingredient ID: NPC119333

Ingredient ID: NPC11708

Ingredient ID: NPC116007

Ingredient ID: NPC115096

Ingredient ID: NPC113961

Ingredient ID: NPC111488

Ingredient ID: NPC10908

Ingredient ID: NPC106786