CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Rhodiola Quadrifida

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TTGTTAATCGTGGATGCACTAGGATCCTTCGGGACTCCATTTGCCTTCCACTCGATCGGCGATGAGCCTTGCGCCCATCGCCGATCGAAACGAATGAACCCCGGCGCGGATCGCGCCAAGGAATCGAAACCGAAAGAACTTGGCTCGGTGGCCCGTTCGCGGGTTGCCAGGGCCATAGGTCTATTCAAAATACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACATATTGTGTTGCCCCCATACATGTATTGGGGGTGAAGCTTGGCCTACCGTGAGCCCAAACTCGCGGATGGCTTAAAAACGAGCCTCGAGACTGTTAGACGTCGCGATAAGTGGTGGTTGCGAGGACTTGTGCCTTCGAGCGTTGCGTGTCGCTGCCGTCGTCCCTCTCTCTCTCGAAATTAATAACCCGAAGGGAGCATCCTCGATGTTTCCAGCA

Click for details-----ITS1

TTGTTAATCGTGGATGCACTTGGATCCTTCGGGTACTCCATTTGCCTTCCCCTCGGTCGGTGATGAGCCTTGCGCCCATTGCTGATCGAAACGAACGAACCCCGGCGCGGATCGCGCCAAGGAATCAAAACCGAAAGAGCTTGGCTCGGTGGCCCGTTCTTGGGTTGCCAGGGCCATAGGTCTATTCAAAATACCATAA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO13635
Plant Latin Name: Rhodiola Quadrifida
Taxonomy Genus: Rhodiola
Taxonomy Family: Crassulaceae

Plant External Links:

NCBI TaxonomyDB: 487764
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

43 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

40 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

3 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC98742

Ingredient ID: NPC86727

Ingredient ID: NPC8202

Ingredient ID: NPC76950

Ingredient ID: NPC7149

Ingredient ID: NPC67144

Ingredient ID: NPC5380

Ingredient ID: NPC39535

Ingredient ID: NPC35573

Ingredient ID: NPC312479

Ingredient ID: NPC308276

Ingredient ID: NPC30416

Ingredient ID: NPC300417

Ingredient ID: NPC294902

Ingredient ID: NPC281580

Ingredient ID: NPC27430

Ingredient ID: NPC268537

Ingredient ID: NPC259910

Ingredient ID: NPC253208

Ingredient ID: NPC250238

Ingredient ID: NPC249196

Ingredient ID: NPC24327

Ingredient ID: NPC24288

Ingredient ID: NPC236404

Ingredient ID: NPC234520

Ingredient ID: NPC23168

Ingredient ID: NPC228705

Ingredient ID: NPC22307

Ingredient ID: NPC21806

Ingredient ID: NPC217532

Ingredient ID: NPC212031

Ingredient ID: NPC210401

Ingredient ID: NPC200984

Ingredient ID: NPC174730

Ingredient ID: NPC173467

Ingredient ID: NPC168326

Ingredient ID: NPC168062

Ingredient ID: NPC167821

Ingredient ID: NPC159669

Ingredient ID: NPC148790

Ingredient ID: NPC123223

Ingredient ID: NPC111119

Ingredient ID: NPC109131

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Metallo protease	MMP2	Matrix metalloproteinase-2	P08253	CHEMBL333
Therapeutic Target	Metallo protease	MMP1	Matrix metalloproteinase-1	P03956	CHEMBL332
Therapeutic Target	Metallo protease	MMP9	Matrix metalloproteinase 9	P14780	CHEMBL321
Therapeutic Target	Transcription factor	NFKB1	Nuclear factor NF-kappa-B p105 subunit	P19838	CHEMBL3251

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	2

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04648917	GASC1 Inhibitor Caffeic Acid for Squamous Esophageal Cell Cancer (ESCC)	esophageal cancer	Caffeic Acid (NPC294902)	NP level
NCT02351622	Caffeic Acid Tablets as a Second-line Therapy for ITP	autoimmune thrombocytopenic purpura	Caffeic Acid (NPC294902)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	MMP9,MMP1,MMP9,MMP1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	MMP9,MMP1,MMP2
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	NFKB1,MMP9,MMP1
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	MMP1,MMP9,MMP2
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	MMP9 MMP9,MMP1
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	MMP9,TDP1,MMP1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	MMP9,TDP1,MMP1
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	MMP9,MMP2,MMP1
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	MMP9,MMP2,MMP1
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	MMP9,MMP2,MMP1
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	TDP1,MMP2,MMP1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	MMP9,MMP9,MMP1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	MMP9,TDP1,MMP1
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	MMP9,MMP2
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	MMP9,NFKB1
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	MMP2,MMP1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	MMP9,MMP1
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	MMP9,MMP1
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	MMP9,MMP2
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	MMP9,MMP1
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	MMP9,MMP1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	MMP9,MMP1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	MMP2,MMP1
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	MMP9,MMP1
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	MMP9,MMP1
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	MMP9,MMP1
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	MMP9,KDM4E
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	MMP9,MMP1
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	MMP9,MMP1
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	MMP9,MMP1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	NFKB1,MMP9
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	MMP9,MMP1
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	MMP2,MMP1
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	MMP9,MMP1
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	NFKB1
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	NFKB1
Ulcerative colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD71	MMP9
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	NFKB1
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	NFKB1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	NFKB1
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	NFKB1
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	NFKB1
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	NFKB1
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	MMP2
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	MMP9
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	NFKB1
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	NFKB1
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	NFKB1
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	NFKB1
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	MMP9
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NFKB1
Hepatic fibrosis/cirrhosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB93	MMP2
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	NCT04648917
Immune thrombocytopenic purpura Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64.10	NCT02351622
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	MMP9
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	NFKB1
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	MMP1
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	MMP9
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	MMP1
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	MMP9
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	MMP1
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	MMP2
Malaria, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F4Z	MMP9
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	MMP2
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MMP9
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	MMP9

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Rhodiola Quadrifida

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

43 All known Ingredients in Total

40 Ingredients with Acceptable Bioavailablity

3 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Hepatocellular carcinoma of liver

Lung cancer

Rheumatoid arthritis

Brain cancer

Crohn disease

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Leishmaniasis

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Mesothelioma of pleura

Renal cell carcinoma

Solid tumour/cancer

Pancreatic cancer

Pheochromocytoma

Inflammatory bowel diseases, unspecified

Osteoarthritis, unspecified

Adenocarcinoma of stomach

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of pancreas

Other specified malignant neoplasms of bronchus or lung

Malignant neoplasms of oesophagus

Urothelial carcinoma of bladder

Cytomegaloviral disease

Chronic rhinosinusitis

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Malignant neoplasms of thymus

Invasive carcinoma of breast

Germ cell tumour of testis

Malignant neoplasms of adrenal gland

Skin and skin-structure infection

Muscular dystrophy

Ulcerative colitis

Choreiform disorder

Atopic eczema

Acute myeloid leukaemia

Acute/subacute hepatic failure

Irritable bowel syndrome

Indeterminate colitis

Lupus erythematosus

Acne vulgaris

Stomach cancer

Fungal infection

Psoriasis

Diabetes mellitus, type unspecified

Type 2 diabetes mellitus

Ischaemic/haemorrhagic stroke

Multiple sclerosis

Hepatic fibrosis/cirrhosis

Esophageal cancer

Immune thrombocytopenic purpura

Non-alcoholic fatty liver disease

West Nile virus infection

Other specified malignant neoplasms ofcolon

Pneumonia due to Pseudomonasaeruginosa

Systemic sclerosis

Systemic lupus erythematosus

Malignant neoplasms of thyroid gland, unspecified

Chikungunya virus disease

Malaria, unspecified