• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Neobalanocarpus Heimii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGATGCCTGCCCAAAGCAGAACGACCCGCGAACGCGTTTTCAAAAACGGGGCGGGAGGGGGAGGGCGCCGGGCTCGCGAGAGCACGTCGTCCCATCCCCTGCCGTGCCACGGGGGCGTGCATGAGCGCCCTGCCGCCCGCGCACGCCCCCCAGCTAACTAACGAACCCCGGCGTGGACCACGCCAAGGAAAACCAACCGGGAGGGTCGCGCCCGCGCACGCGGGCCGCGCCTTCCGCAACTACAAAAA

Click for details-----ITS2

AACGTCGTCCCCCCCTCCCTCCGCGCCTGGAGGCGTGGCTCAGGGACGAGGGCGGATGCTGGCCTCCCGTGCGCACTTCCCGCTCGCGGTTGGCCCAAAAGTGAGTCCCCGGCGCCGGGCGCAAGGGCAAGCGGTGGCCGCTCGCGTGTCCATGTGTCCCCTGCGCACCCCGGCGTCCCGTGGGGAGCTCGTCCGGACCCTAACGCGCCGTCCTGCTCTCAGGACGGCCTCGCA
Taxonomic Information

Plant ID: NPO13523
Plant Latin Name: Neobalanocarpus Heimii
Taxonomy Genus: Neobalanocarpus
Taxonomy Family: Dipterocarpaceae

Plant External Links:

NCBI TaxonomyDB: 64595
Plant-of-the-World-Online: 321115-1

Used in Medicines

Unknown.

Geographical Distribution

Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

61 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


26 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

38 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97444

Ingredient ID: NPC85799

Ingredient ID: NPC76128

Ingredient ID: NPC69266

Ingredient ID: NPC65530

Ingredient ID: NPC58628

Ingredient ID: NPC53168

Ingredient ID: NPC50898

Ingredient ID: NPC5029

Ingredient ID: NPC48367

Ingredient ID: NPC3845

Ingredient ID: NPC3357

Ingredient ID: NPC312929

Ingredient ID: NPC30432

Ingredient ID: NPC303422

Ingredient ID: NPC29874

Ingredient ID: NPC289346

Ingredient ID: NPC288089

Ingredient ID: NPC282923

Ingredient ID: NPC276222

Ingredient ID: NPC273557

Ingredient ID: NPC272865

Ingredient ID: NPC271385

Ingredient ID: NPC26080

Ingredient ID: NPC254847

Ingredient ID: NPC254603

Ingredient ID: NPC252169

Ingredient ID: NPC248949

Ingredient ID: NPC248573

Ingredient ID: NPC245584

Ingredient ID: NPC242712

Ingredient ID: NPC235784

Ingredient ID: NPC22697

Ingredient ID: NPC226906

Ingredient ID: NPC225710

Ingredient ID: NPC22563

Ingredient ID: NPC223004

Ingredient ID: NPC221090

Ingredient ID: NPC219876

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC192916

Ingredient ID: NPC19256

Ingredient ID: NPC191011

Ingredient ID: NPC190457

Ingredient ID: NPC190078

Ingredient ID: NPC189142

Ingredient ID: NPC179950

Ingredient ID: NPC178851

Ingredient ID: NPC176740

Ingredient ID: NPC173637

Ingredient ID: NPC161571

Ingredient ID: NPC157517

Ingredient ID: NPC156654

Ingredient ID: NPC142153

Ingredient ID: NPC139508

Ingredient ID: NPC13674

Ingredient ID: NPC118284

Ingredient ID: NPC111772

Ingredient ID: NPC109879

Ingredient ID: NPC108167