• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Scorzonera Pseudodivaricata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCAAAGCAGAACGACCCGCGAACATGTACTCATAATTAGGAGATGGGGGAACAGGCGAAGGCCTCGATCCTTGTTTCCTGTTGGTGTGCGCTTGTGGTGCCCCATTTGGAGTGCCACGGACGTTCCGCTAACAACCTAACCAACCCCGGCACGGAATGTGCCAAGGAAAACAAAACAAAAGAAGGGTGCGCCCCGTGTTGCCCCGTTTGCGGTGTGCATGCGGGTCGTGGCCTCCTGTAAACACAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCTCCCCCATGTATCCTTTTGGGATGCACGGTATCGGGGCGGAGATTGGCCTCCCGTGATCTTGTTGCGGTTGGCCCAAACACGAGTCCCTTTAGGTGGACGCACGACTCGTGGTGGTGGAATAGGCCCTCGTCATTTGTCGTGTGTCGTTCGCTGCAAGGGACACAAGACCCCAATGCATTGTCTAACGATGATGCTTCG

Click for details-----ITS1

TCGAAACCTGCAAAGCAGAACGACCCGCGAACATGTACTCATAATTAGGAGATGGGGGAACAGGCGAAGGCCTCGATCCTTGTTTCCTGTTGGTGTGCGCTTGTGGTGCCCCATTTGGAGTGCCACGGACGTTCCGCTAACAACCTAACCAACCCCGGCACGGAATGTGCCAAGGAAAACAAAACAAAAGAAGGGTGCGCCCCGTGTTGCCCCGTTTGCGGTGTGCATGCGGGTCGTGGCCTCCTGTAAACACAAAA

Click for details-----ITS2

ATCGCGTTGCTCCCCCATGTATCCTTTTGGGATGCACGGTATCGGGGCGGAGATTGGCCTCCCGTGATCTTGTTGCGGTTGGCCCAAACACGAGTCCCCTTCGGTGGATGCACGACTAGTGGTGGTTGAATAGGCCCTCTTCTTTTGTCGTGTGTCGTTTGCTGCAAGGGATCCTCTCGTATAAGACCCCAATGCATTCTCTAACGATGATGCTTCGA
Taxonomic Information

Plant ID: NPO13478
Plant Latin Name: Scorzonera Pseudodivaricata
Taxonomy Genus: Scorzonera
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 1439928
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

196 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


132 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

83 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99762

Ingredient ID: NPC98254

Ingredient ID: NPC95172

Ingredient ID: NPC94721

Ingredient ID: NPC93740

Ingredient ID: NPC91494

Ingredient ID: NPC90231

Ingredient ID: NPC89461

Ingredient ID: NPC88603

Ingredient ID: NPC87775

Ingredient ID: NPC83723

Ingredient ID: NPC8180

Ingredient ID: NPC80380

Ingredient ID: NPC79359

Ingredient ID: NPC78975

Ingredient ID: NPC76145

Ingredient ID: NPC71483

Ingredient ID: NPC71032

Ingredient ID: NPC69126

Ingredient ID: NPC68709

Ingredient ID: NPC68517

Ingredient ID: NPC66577

Ingredient ID: NPC66349

Ingredient ID: NPC65741

Ingredient ID: NPC65739

Ingredient ID: NPC65611

Ingredient ID: NPC63453

Ingredient ID: NPC63270

Ingredient ID: NPC6148

Ingredient ID: NPC60009

Ingredient ID: NPC59041

Ingredient ID: NPC58190

Ingredient ID: NPC55930

Ingredient ID: NPC53015

Ingredient ID: NPC48872

Ingredient ID: NPC48264

Ingredient ID: NPC473275

Ingredient ID: NPC470896

Ingredient ID: NPC470895

Ingredient ID: NPC43708

Ingredient ID: NPC4154

Ingredient ID: NPC41461

Ingredient ID: NPC38455

Ingredient ID: NPC38109

Ingredient ID: NPC38041

Ingredient ID: NPC37872

Ingredient ID: NPC37500

Ingredient ID: NPC37250

Ingredient ID: NPC36895

Ingredient ID: NPC36878

Ingredient ID: NPC36417

Ingredient ID: NPC32739

Ingredient ID: NPC311317

Ingredient ID: NPC310889

Ingredient ID: NPC310046

Ingredient ID: NPC307594

Ingredient ID: NPC306968

Ingredient ID: NPC30412

Ingredient ID: NPC303870

Ingredient ID: NPC302327

Ingredient ID: NPC29883

Ingredient ID: NPC295286

Ingredient ID: NPC289974

Ingredient ID: NPC289794

Ingredient ID: NPC288932

Ingredient ID: NPC287120

Ingredient ID: NPC285049

Ingredient ID: NPC284512

Ingredient ID: NPC283965

Ingredient ID: NPC280965

Ingredient ID: NPC280073

Ingredient ID: NPC278711

Ingredient ID: NPC278545

Ingredient ID: NPC27765

Ingredient ID: NPC276928

Ingredient ID: NPC275766

Ingredient ID: NPC273929

Ingredient ID: NPC273054

Ingredient ID: NPC272068

Ingredient ID: NPC270463

Ingredient ID: NPC270177

Ingredient ID: NPC269198

Ingredient ID: NPC266372

Ingredient ID: NPC265040

Ingredient ID: NPC26401

Ingredient ID: NPC263375

Ingredient ID: NPC263140

Ingredient ID: NPC260433

Ingredient ID: NPC259551

Ingredient ID: NPC259182

Ingredient ID: NPC256623

Ingredient ID: NPC256186

Ingredient ID: NPC25287

Ingredient ID: NPC250242

Ingredient ID: NPC249606

Ingredient ID: NPC249281

Ingredient ID: NPC248479

Ingredient ID: NPC247266

Ingredient ID: NPC246202

Ingredient ID: NPC245853

Ingredient ID: NPC243796

Ingredient ID: NPC243728

Ingredient ID: NPC243702

Ingredient ID: NPC242895

Ingredient ID: NPC242723

Ingredient ID: NPC242117

Ingredient ID: NPC241921

Ingredient ID: NPC240431

Ingredient ID: NPC236386

Ingredient ID: NPC236202

Ingredient ID: NPC235279

Ingredient ID: NPC232712

Ingredient ID: NPC231949

Ingredient ID: NPC23126

Ingredient ID: NPC230138

Ingredient ID: NPC226636

Ingredient ID: NPC225710

Ingredient ID: NPC224877

Ingredient ID: NPC222997

Ingredient ID: NPC222423

Ingredient ID: NPC220998

Ingredient ID: NPC220488

Ingredient ID: NPC219913

Ingredient ID: NPC219876

Ingredient ID: NPC219251

Ingredient ID: NPC217965

Ingredient ID: NPC215412

Ingredient ID: NPC214454

Ingredient ID: NPC21350

Ingredient ID: NPC213157

Ingredient ID: NPC212696

Ingredient ID: NPC212404

Ingredient ID: NPC20791

Ingredient ID: NPC206544

Ingredient ID: NPC204982

Ingredient ID: NPC203819

Ingredient ID: NPC202742

Ingredient ID: NPC200819

Ingredient ID: NPC193180

Ingredient ID: NPC192638

Ingredient ID: NPC19263

Ingredient ID: NPC192304

Ingredient ID: NPC191926

Ingredient ID: NPC190217

Ingredient ID: NPC187802

Ingredient ID: NPC187112

Ingredient ID: NPC187095

Ingredient ID: NPC186727

Ingredient ID: NPC183486

Ingredient ID: NPC181465

Ingredient ID: NPC179950

Ingredient ID: NPC179739

Ingredient ID: NPC1786

Ingredient ID: NPC176740

Ingredient ID: NPC1713

Ingredient ID: NPC170035

Ingredient ID: NPC168717

Ingredient ID: NPC168383

Ingredient ID: NPC166138

Ingredient ID: NPC164703

Ingredient ID: NPC162304

Ingredient ID: NPC157414

Ingredient ID: NPC156654

Ingredient ID: NPC156544

Ingredient ID: NPC156080

Ingredient ID: NPC154588

Ingredient ID: NPC153439

Ingredient ID: NPC149101

Ingredient ID: NPC1486

Ingredient ID: NPC148020

Ingredient ID: NPC14725

Ingredient ID: NPC146642

Ingredient ID: NPC145053

Ingredient ID: NPC14375

Ingredient ID: NPC140201

Ingredient ID: NPC140076

Ingredient ID: NPC139565

Ingredient ID: NPC138113

Ingredient ID: NPC137894

Ingredient ID: NPC13575

Ingredient ID: NPC133671

Ingredient ID: NPC132235

Ingredient ID: NPC130775

Ingredient ID: NPC1293

Ingredient ID: NPC127696

Ingredient ID: NPC126029

Ingredient ID: NPC124531

Ingredient ID: NPC123216

Ingredient ID: NPC116775

Ingredient ID: NPC112242

Ingredient ID: NPC109813

Ingredient ID: NPC109782

Ingredient ID: NPC108811

Ingredient ID: NPC106025

Ingredient ID: NPC104195

Ingredient ID: NPC103402