• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Castanea Sativa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTTGCCCCCCCCCCTCAACTCCGGTTCGGGCGGGGCGGAAGTTGGCCTCCCGTGCGCGCCCGCGCGCGCGGTTAGCCCAAAAGCGAGTCCTCGGCGACGAGCGCCACGACAATCGGTGGTTCTTCGACCCTCGTTCCCCGTCGTGCGCGCCCCGTCGCCCGAACGCGCTCTCGAGACCCTGACGCGTCGCCTCGGCGGCGCTCCCA
Taxonomic Information

Plant ID: NPO13445
Plant Latin Name: Castanea Sativa
Taxonomy Genus: Castanea
Taxonomy Family: Fagaceae

Plant External Links:

NCBI TaxonomyDB: 21020
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

26 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


23 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

19 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC93888

Ingredient ID: NPC75945

Ingredient ID: NPC62045

Ingredient ID: NPC59052

Ingredient ID: NPC39426

Ingredient ID: NPC33666

Ingredient ID: NPC317120

Ingredient ID: NPC295644

Ingredient ID: NPC281686

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC237812

Ingredient ID: NPC226453

Ingredient ID: NPC208793

Ingredient ID: NPC203468

Ingredient ID: NPC201284

Ingredient ID: NPC185755

Ingredient ID: NPC178383

Ingredient ID: NPC174246

Ingredient ID: NPC152451

Ingredient ID: NPC137958

Ingredient ID: NPC126681

Ingredient ID: NPC120942

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC109098