• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Castanea Sativa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTTGCCCCCCCCCCTCAACTCCGGTTCGGGCGGGGCGGAAGTTGGCCTCCCGTGCGCGCCCGCGCGCGCGGTTAGCCCAAAAGCGAGTCCTCGGCGACGAGCGCCACGACAATCGGTGGTTCTTCGACCCTCGTTCCCCGTCGTGCGCGCCCCGTCGCCCGAACGCGCTCTCGAGACCCTGACGCGTCGCCTCGGCGGCGCTCCCA
Taxonomic Information

Plant ID: NPO13445
Plant Latin Name: Castanea Sativa
Taxonomy Genus: Castanea
Taxonomy Family: Fagaceae

Plant External Links:

NCBI TaxonomyDB: 21020
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

26 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


23 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

19 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC93888

Ingredient ID: NPC75945

Ingredient ID: NPC62045

Ingredient ID: NPC59052

Ingredient ID: NPC39426

Ingredient ID: NPC33666

Ingredient ID: NPC317120

Ingredient ID: NPC295644

Ingredient ID: NPC281686

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC237812

Ingredient ID: NPC226453

Ingredient ID: NPC208793

Ingredient ID: NPC203468

Ingredient ID: NPC201284

Ingredient ID: NPC185755

Ingredient ID: NPC178383

Ingredient ID: NPC174246

Ingredient ID: NPC152451

Ingredient ID: NPC137958

Ingredient ID: NPC126681

Ingredient ID: NPC120942

Ingredient ID: NPC11433

Ingredient ID: NPC112890

Ingredient ID: NPC109098

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 3 CYP3A4 Cytochrome P450 3A4 P08684 CHEMBL340
Therapeutic Target Enzyme BLM Bloom syndrome protein P54132 CHEMBL1293237
Therapeutic Target Ionotropic glutamate receptor GRIK5 Glutamate receptor ionotropic kainate 5 Q16478 CHEMBL2675
Therapeutic Target Ionotropic glutamate receptor GRIK3 Glutamate receptor ionotropic kainate 3 Q13003 CHEMBL3684
Therapeutic Target Ionotropic glutamate receptor GRIA4 Glutamate receptor ionotropic, AMPA 4 P48058 CHEMBL3190
Therapeutic Target Ionotropic glutamate receptor GRIK1 Glutamate receptor ionotropic kainate 1 P39086 CHEMBL1918
Therapeutic Target Nuclear hormone receptor subfamily 1 NR1H4 Bile acid receptor FXR Q96RI1 CHEMBL2047
Therapeutic Target Nuclear hormone receptor subfamily 3 ESRRB Estrogen-related receptor beta O95718 CHEMBL3751
Therapeutic Target Nuclear hormone receptor subfamily 3 ESRRA Estrogen-related receptor alpha P11474 CHEMBL3429
Therapeutic Target Nuclear hormone receptor subfamily 3 ESR2 Estrogen receptor beta Q92731 CHEMBL242
Therapeutic Target Nuclear hormone receptor subfamily 3 ESR1 Estrogen receptor alpha P03372 CHEMBL206
Therapeutic Target Oxidoreductase AOX1 Aldehyde oxidase Q06278 CHEMBL3257
Therapeutic Target Protein Kinase MAP2K4 Dual specificity mitogen-activated protein kinase kinase 4 P45985 CHEMBL2897
Therapeutic Target Serine protease DPP4 Dipeptidyl peptidase IV P27487 CHEMBL284
Therapeutic Target Small molecule receptor (family C GPCR) GRM8 Metabotropic glutamate receptor 8 O00222 CHEMBL3228
Therapeutic Target Small molecule receptor (family C GPCR) GRM1 Metabotropic glutamate receptor 1 Q13255 CHEMBL3772
Therapeutic Target Structural protein LMNA Prelamin-A/C P02545 CHEMBL1293235
Therapeutic Target Transcription factor NFKB1 Nuclear factor NF-kappa-B p105 subunit P19838 CHEMBL3251
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level158
Plant level1
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT00575848 Study of the Effects of Glycine on Symptoms and Memory in Patients With Schizophrenia schizoaffective disorder;schizophrenia Glycine (NPC126681) NP level
NCT00147368 Arginine Malaria Trial: Study of Adjunctive Arginine in Falciparum Malaria Plasmodium falciparum malaria Arginine (NPC226453) NP level
NCT00596895 Isoflavone in Prostate-specific Antigen Recurrent Prostate Cancer prostate cancer Isoflavone (NPC201284) NP level
NCT01042535 Vaccine Therapy and 1-MT in Treating Patients With Metastatic Breast Cancer male breast carcinoma Tryptophan (NPC203468) NP level
NCT01266018 Study of ADI-PEG 20 in Patients With Relapsed Sensitive or Refractory Small Cell Lung Cancer small cell lung carcinoma Arginine (NPC226453) NP level
NCT00047983 Omega-3 Fatty Acids That Affect the Immune System in Kidney Transplant Patients kidney disease Arginine (NPC226453) NP level
NCT03956056 Neoantigen Peptide Vaccine Strategy in Pancreatic Cancer Patients Following Surgical Resection and Adjuvant Chemotherapy pancreatic carcinoma Lysine (NPC112890) NP level
NCT00287690 Isoflavones and the Coronary Circulation in Men and Women With Coronary Artery Disease coronary artery disease Genistein (NPC39426) NP level
NCT00005107 Role of Nitric Oxide in Cirrhosis: Relationship With Systemic Hemodynamics, Renal Function, Vasoactive Systems and Endotoxemia cirrhosis of liver Arginine (NPC226453) NP level
NCT01720316 Neurobiology of a Mutation in Glycine Metabolism in Psychotic Disorders bipolar disorder Glycine (NPC126681) NP level
NCT05025488 Mutant CALR-peptide Based Vaccine in Patients With Mutated CALR Myeloproliferative Neoplasm essential thrombocythemia;myelofibrosis Lysine (NPC112890) NP level
NCT01468038 A Double-blind Placebo Controlled Trial of Sentra PM, a Medical Food Sleep Disorder L-Glutamate (NPC137958) NP level
NCT01958372 Radiation Therapy, Chemotherapy, and Soy Isoflavones in Treating Patients With Stage IIIA-IIIB Non-Small Cell Lung Cancer lung adenocarcinoma Isoflavone (NPC201284) NP level
NCT04249336 Clinical Efficacy Of BioMin F, Colgate Sensitive Pro-Relief And Sensodyne Rapid Action Dentifrices In DH allergic disease Arginine (NPC226453) NP level
NCT01126879 Genistein in Treating Patients With Prostate Cancer prostate adenocarcinoma Genistein (NPC39426) NP level
NCT03606967 Testing the Addition of an Individualized Vaccine to Nab-Paclitaxel, Durvalumab and Tremelimumab and Chemotherapy in Patients With Metastatic Triple Negative Breast Cancer breast carcinoma Lysine (NPC112890) NP level
NCT00338221 Clinical Trial of Alanyl-Glutamine or Glycine in Children With Persistent Diarrhea or Malnutrition malnutrition Glycine (NPC126681) NP level
NCT01871766 Risk-Adapted Focal Proton Beam Radiation and/or Surgery in Patients With Low, Intermediate and High Risk Rhabdomyosarcoma Receiving Standard or Intensified Chemotherapy rhabdomyosarcoma Methionine (NPC152451) NP level
NCT00000372 Glycine and D-Cycloserine in Schizophrenia schizophrenia Glycine (NPC126681) NP level
NCT02388178 To Determine the Ability of a New Product Formulation to Remineralize an Early Caries Lesion by an In-situ Study dental caries Arginine (NPC226453) NP level
NCT00408577 Prevention of Cardiac and Vascular Events in Patients With NGT/IGT. cardiovascular disease Arginine (NPC226453) NP level
NCT03493178 Glutathione in Mild Cognitive Impairment Cognitive impairment Glycine (NPC126681) NP level
NCT00058266 Genistein in Treating Patients With Localized Prostate Cancer Who Are Planning to Undergo Radical Prostatectomy prostate cancer Genistein (NPC39426) NP level
NCT00513617 Effectiveness of Arginine as a Treatment for Sickle Cell Anemia sickle cell anemia Arginine (NPC226453) NP level
NCT00222235 Adjunctive Treatment for Decreasing Symptoms of Schizophrenia schizoaffective disorder;schizophrenia Glycine (NPC126681) NP level
NCT02618824 Role of Terminal Warm Blood Cardioplegia as Myocardial Protection in the Use of Histidine-Tryptophan-Ketoglutarate Cardioplegia in Complex Congenital Heart Surgery congenital heart disease Tryptophan (NPC203468);Histidine (NPC237812) NP level
NCT04740580 Glutathione, Brain Metabolism and Inflammation in Alzheimer's Disease Alzheimer disease Glycine (NPC126681) NP level
NCT00405665 The Short Term Safety and Efficacy of Inhaled L-arginine in Patients With Cystic Fibrosis cystic fibrosis Arginine (NPC226453) NP level
NCT02129075 A Vaccine (CDX-1401) With or Without a Biologic Drug (CDX-301) for the Treatment of Patients With Stage IIB-IV Melanoma cutaneous melanoma Lysine (NPC112890) NP level
NCT02447874 Arginine Therapy for the Treatment of Pain in Children With Sickle Cell Disease sickle cell anemia Arginine (NPC226453) NP level
NCT00005827 Genistein in Treating Patients With Stage II, Stage III, or Stage IV Prostate Cancer prostate cancer Genistein (NPC39426) NP level
NCT00546039 Synthetic Genistein (BONISTEIN™) in Patients Who Are Undergoing Surgery for Prostate Cancer prostate adenocarcinoma Genistein (NPC39426) NP level
NCT01842139 Vaccine Therapy and Basiliximab in Treating Patients With Acute Myeloid Leukemia in Complete Remission acute myeloid leukemia Lysine (NPC112890) NP level
NCT02017249 Efficacy Study of Oral Arginine to Improve Immune Function in Glioblastoma Multiforme glioblastoma multiforme Arginine (NPC226453) NP level
NCT04616248 In Situ Immunomodulation With CDX-301, Radiation Therapy, CDX-1140 and Poly-ICLC in Patients w/ Unresectable and Metastatic Solid Tumors breast carcinoma Lysine (NPC112890) NP level
NCT00986609 MUC1 Vaccine for Triple-negative Breast Cancer inflammatory breast carcinoma;triple-negative breast cancer Lysine (NPC112890) NP level
NCT01783431 Study of Vaccination With Poly-ICLC and Peptide-pulsed Dendritic Cells melanoma Lysine (NPC112890) NP level
NCT00200746 Treatment of Alcohol-Related Hepatitis With Arginine Hepatitis, Alcoholic Arginine (NPC226453) NP level
NCT03887169 Administration of Methionine in Patients With Pulmonary Alveolar Proteinosis by Mutation of the MARS Gene. pulmonary alveolar proteinosis Methionine (NPC152451) NP level
NCT00280683 Effects of L-arginine Supplementation in Adults With Moderate to Severe Asthma asthma Arginine (NPC226453) NP level
NCT01142219 L-Arginine and Sickle Cell Disease sickle cell anemia Arginine (NPC226453) NP level
NCT00290758 Genistein in Preventing Breast Cancer in Women at High Risk for Breast Cancer breast cancer Genistein (NPC39426) NP level
NCT01191216 1-Methyl-D-Tryptophan and Docetaxel in Treating Patients With Metastatic Solid Tumors neoplasm Tryptophan (NPC203468) NP level
NCT00006136 Phase II Study of Arginine Butyrate With or Without Epoetin Alfa in Patients With Thalassemia Intermedia Beta-thalassemia Arginine (NPC226453) NP level
NCT00029796 Isoflavones and Acute-phase Response in Chronic Renal Failure chronic kidney disease Isoflavone (NPC201284) NP level
NCT00078923 Soy Isoflavones in Treating Patients Who Are Undergoing Radical Prostatectomy for Stage I or Stage II Adenocarcinoma of the Prostate prostate cancer Isoflavone (NPC201284) NP level
NCT01985763 Genistein in Treatment of Metastatic Colorectal Cancer colorectal carcinoma;malignant colon neoplasm;rectum cancer Genistein (NPC39426) NP level
NCT00134433 Endothelial Modulation for Angiogenic Therapy coronary artery disease Arginine (NPC226453) NP level
NCT00157521 L-Arginine in Pre-Eclampsia preeclampsia Arginine (NPC226453) NP level
NCT01345474 Phase 3 Clinical Trial: D-methionine to Reduce Noise-Induced Hearing Loss (NIHL) noise-induced hearing loss Methionine (NPC152451) NP level
NCT01796678 Arginine Therapy in Sickle Cell Disease-VOC Clinical Trial pain Arginine (NPC226453) NP level
NCT01603446 L-arginine Therapy on Endothelium-dependent Vasodilation & Mitochondrial Metabolism in MELAS Syndrome MELAS Arginine (NPC226453) NP level
NCT01419067 A Phase II Trial of Limited Surgery and Proton Therapy for Craniopharyngioma or Observation After Radical Resection Craniopharyngioma Methionine (NPC152451) NP level
NCT02903355 Phase 3 Clinical Trial: D-methionine to Reduce Noise-Induced Hearing Loss (NIHL) noise-induced hearing loss Methionine (NPC152451) NP level
NCT04345705 Poly-ICLC (Hiltonol®) Vaccine In Malignant Pleural Mesothelioma mesothelioma Lysine (NPC112890) NP level
NCT01324115 NG-Nitro-L-Arginine in Treating Patients With Advanced Solid Tumors neoplasm Arginine (NPC226453) NP level
NCT02744820 Multiple Ascending Dose Study of GMC-252-L-Lys Salt in Healthy Subjects and Type 2 Diabetics type 2 diabetes mellitus Lysine (NPC112890) NP level
NCT04631536 Managing Endothelial Dysfunction in COVID-19 : A Randomized Controlled Trial at LAUMC COVID-19 Arginine (NPC226453) NP level
NCT00262730 Radiation Therapy and Temozolomide Followed by Temozolomide and Poly ICLC in Treating Patients With Newly Diagnosed GBM glioblastoma multiforme Lysine (NPC112890) NP level
NCT00276263 Sarcosine Preventive Therapy for Individuals At High Risk for Schizophrenia schizophrenia Glycine (NPC126681) NP level
NCT00010686 Dietary Phytoestrogens and Bone Metabolism osteoporosis Genistein (NPC39426) NP level
NCT00268749 Glycine Treatment of Prodromal Symptoms schizophrenia Glycine (NPC126681) NP level
NCT01388764 Safety, Tolerability and Effects of L-Arginine in Boys With Dystrophinopathy on Corticosteroids Duchenne muscular dystrophy Arginine (NPC226453) NP level
NCT00235924 Study Assessing the Effects on Endometrium and Breast of Isoflavone in Post Menopausal Women menopause Isoflavone (NPC201284) NP level
NCT04364750 Biomarkers of Diet-microbiota Interactions in Irritable Bowel Syndrome irritable bowel syndrome Histidine (NPC237812) NP level
NCT00344734 Effects of Acute L-NMMA Treatment on Renal Hemodynamics and Vasoactive Hormones in Patients With Congestive Heart Failure congestive heart failure Arginine (NPC226453) NP level
NCT01287585 Ph 3 ADI-PEG 20 Versus Placebo in Subjects With Advanced Hepatocellular Carcinoma Who Have Failed Prior Systemic Therapy hepatocellular carcinoma Arginine (NPC226453) NP level
NCT03121677 Personalized Tumor Vaccine Strategy and PD-1 Blockade in Patients With Follicular Lymphoma follicular lymphoma Lysine (NPC112890) NP level
NCT00244933 Gemcitabine Hydrochloride and Genistein in Treating Women With Stage IV Breast Cancer breast cancer Genistein (NPC39426) NP level
NCT05042024 Supplementation With L-ornithine But Not L-arginine Increases Density of CD68+ and CD163+ Macrophages in Periodontitis periodontitis Arginine (NPC226453) NP level
NCT00571766 Effects of Oral L-Arginine on Chronic Hypertension in Pregnancy preeclampsia Arginine (NPC226453) NP level
NCT02766478 Genistein Supplementation to Mitigate Cardiometabolic Dysfunction in Patients Undergoing Androgen Deprivation Therapy for Prostate Cancer prostate cancer Genistein (NPC39426) NP level
NCT04482595 BIO 300 Oral Suspension in Previously Hospitalized Long COVID Patients pulmonary fibrosis;severe acute respiratory syndrome Genistein (NPC39426) NP level
NCT03640949 Vasopressin and Methylprednisolone for In-Hospital Cardiac Arrest sudden cardiac arrest Arginine (NPC226453) NP level
NCT00344916 Phase 1 Study of L-NMMA in Patients With Liver Cirrhosis cirrhosis of liver Arginine (NPC226453) NP level
NCT00929370 A Repeat Dose Study With GSK1018921 to Assess Safety, Tolerability, Pharmacokinetics, Pharmacodynamics in Healthy Volunteers and Patients With Schizophrenia and to Evaluate Its Effect on PK of Midazolam. schizophrenia Glycine (NPC126681) NP level
NCT00694564 Evaluation of S-adenosyl Methionine (SAM-e) for Recurrent Abdominal Pain in Children Abdominal pain Methionine (NPC152451) NP level
NCT00108589 S-Adenosylmethionine Therapy for Non-Alcoholic Steatohepatitis Hepatitis Methionine (NPC152451) NP level
NCT00058123 Poly-ICLC in Treating Patients With Recurrent or Progressive Anaplastic Glioma Central Nervous System Neoplasm Lysine (NPC112890) NP level
NCT03266965 Histaminergic Basis of Central Fatigue in Multiple Sclerosis - A Novel Approach multiple sclerosis Histidine (NPC237812) NP level
NCT03580122 The Effect of Arginine on Classic Galactosemia classic galactosemia Arginine (NPC226453) NP level
NCT02516085 Improved Muscle Function in Duchenne Muscular Dystrophy Through L-Arginine and Metformin Duchenne muscular dystrophy Arginine (NPC226453) NP level
NCT01188096 A Trial of Poly-ICLC in the Management of Recurrent Pediatric Low Grade Gliomas brain neoplasm Lysine (NPC112890) NP level
NCT00584532 Effects of a Genistein Concentrated Polysaccharide (GCP) for Prostate Cancer on Active Surveillance. prostate cancer Genistein (NPC39426) NP level
NCT03166228 Hemodynamic Changes During Operative Hysteroscopy hypertension Glycine (NPC126681) NP level
NCT00000324 Tryptophan and Behavior Therapy for Cocaine Abuse - 1 cocaine dependence Tryptophan (NPC203468) NP level
NCT01489813 Study of Genistein in Reducing Side Effects of Superficial Bladder Cancer Treatment urinary bladder cancer Genistein (NPC39426) NP level
NCT00137124 L-Arginine Metabolism in Essential Hypertension essential hypertension Arginine (NPC226453) NP level
NCT01031927 N-methyl Glycine (Sarcosine) for the Treatment of Obsessive Compulsive Disorder (OCD) obsessive-compulsive disorder Glycine (NPC126681) NP level
NCT01417481 Effect of Glycine in Cystic Fibrosis cystic fibrosis Glycine (NPC126681) NP level
NCT02440061 Ghrelin and Beta Cell Function in Diabetes type 2 diabetes mellitus Arginine (NPC226453) NP level
NCT00573313 Effects of SAMe in Patients With Alcoholic Liver Disease liver disease Methionine (NPC152451) NP level
NCT00133406 Long-term Impact and Intervention for Diarrhea in Brazil diarrheal disease Glycine (NPC126681) NP level
NCT04703036 Glutathione, Oxidative Stress and Mitochondrial Function in COVID-19 COVID-19 Glycine (NPC126681) NP level
NCT00882765 Genistein in Treating Patients With Pancreatic Cancer That Can Be Removed by Surgery pancreatic carcinoma Genistein (NPC39426) NP level
NCT00475176 S-Adenosyl Methionine (SAMe) to Treat Patients With Chronic Hepatitis C chronic hepatitis C virus infection Methionine (NPC152451) NP level
NCT00513916 Effect of Dietary Soy on Estrogens in Breast Fluid, Blood, and Urine Samples From Healthy Women breast cancer Isoflavone (NPC201284) NP level
NCT00005658 Glycine to Treat Psychotic Disorders in Children schizophrenia Glycine (NPC126681) NP level
NCT02291458 L-arginine and Brown Adipose Tissue Glucose intolerance Arginine (NPC226453) NP level
NCT01920191 Phase I/II Trial of IMA950 Multi-peptide Vaccine Plus Poly-ICLC in Glioblastoma neoplasm Lysine (NPC112890) NP level
NCT02586285 Effect of S-Adenosyl Methionine Treatment on Recurrence After Curative Resection of Hepatocellular Carcinoma hepatocellular carcinoma Methionine (NPC152451) NP level
NCT00001696 A Pharmacokinetic Study of Genistein, a Tyrosine Kinase Inhibitor cancer Genistein (NPC39426) NP level
NCT00616304 Safety and Preliminary Efficacy of L-arginine in Severe Falciparum Malaria Plasmodium falciparum malaria Arginine (NPC226453) NP level
NCT01664650 Effects of Genistein in Postmenopausal Women With Metabolic Syndrome metabolic syndrome Genistein (NPC39426) NP level
NCT00917826 Study of Arginine Butyrate and Ganciclovir/Valganciclovir in EBV(+) Lymphoid Malignancies lymphoma Arginine (NPC226453) NP level
NCT04535427 Role of L-Arginine Supplementation in the Treatment of Rheumatoid Arthritis rheumatoid arthritis Arginine (NPC226453) NP level
NCT04054973 L-arginine Study for Persistent Symptoms of Schizophrenia schizophrenia Arginine (NPC226453) NP level
NCT02125786 A Trial of Surgery and Fractionated Re-Irradiation for Recurrent Ependymoma ependymoma Methionine (NPC152451) NP level
NCT01501942 Efficacy, Safety, Tolerability, Pharmacodynamics and Pharmacokinetics of Oral Administration of AIM-102 in Patients With Mild to Moderate Allergic Asthma asthma Glycine (NPC126681) NP level
NCT01263041 Effect of L-arginine and Glutamine on Preterm Sepsis Arginine (NPC226453) NP level
NCT02929888 Study of Platelet Function After Administration of Aspirin Versus Lysine Acetylsalicylate in STEMI Patients acute myocardial infarction Lysine (NPC112890) NP level
NCT00118040 Phase II Study of Isoflavone G-2535 (Genistein) in Patients With Bladder Cancer urinary bladder carcinoma Genistein (NPC39426) NP level
NCT00052715 Biological Therapy and Radiation Therapy in Treating Patients With Newly Diagnosed Glioblastoma Multiforme Central Nervous System Neoplasm Lysine (NPC112890) NP level
NCT02061449 Poly ICLC, Radiation, and Romidepsin for Advanced Cutaneous T Cell Lymphoma Cutaneous T-cell lymphoma Lysine (NPC112890) NP level
NCT00541710 Effect of Genistein in Women With Metabolic Syndrome metabolic syndrome Genistein (NPC39426) NP level
NCT00567931 1-Methyl-D-Tryptophan in Treating Patients With Metastatic or Refractory Solid Tumors That Cannot Be Removed By Surgery neoplasm Tryptophan (NPC203468) NP level
NCT05470998 L-Arginine in Children Having Sickle Cell Disease With Increased Tricuspid Regurgitant Jet Velocity sickle cell anemia Arginine (NPC226453) NP level
NCT01140646 Evaluation of SAMe for Hot Flashes Hot flashes Methionine (NPC152451) NP level
NCT03861416 "Unifuzol®" in Patients With Peripheral Arterial Disease peripheral arterial disease Arginine (NPC226453) NP level
NCT01628471 MTD Determination, Safety and Efficacy of the Decitabine-Genistein Drug Combination in Advanced Solid Tumors and Non-Small Cell Lung Cancer non-small cell lung carcinoma Genistein (NPC39426) NP level
NCT00345605 Arginine and Buphenyl in Patients With Argininosuccinic Aciduria (ASA), a Urea Cycle Disorder argininosuccinic aciduria Arginine (NPC226453) NP level
NCT01607879 Use of β-hydroxy-β-methylbutyrate to Counteract Muscle Loss in Men With Prostate Cancer on Androgen Ablation prostate cancer Arginine (NPC226453) NP level
NCT00291226 Glycine vs Placebo for the Schizophrenia Prodrome schizophrenia Glycine (NPC126681) NP level
NCT00179556 Effects of Soy Isoflavones on Menopausal Hot Flashes menopause Isoflavone (NPC201284) NP level
NCT00223717 Treatment of Supine Hypertension in Autonomic Failure hypertension Arginine (NPC226453) NP level
NCT00590538 Phenylbutyrate/Genistein Duotherapy in Delta F508-Heterozygotes (for Cystic Fibrosis) cystic fibrosis Genistein (NPC39426) NP level
NCT02067975 Tryptophan MRI in People With Schizophrenia and Healthy Controls schizophrenia Tryptophan (NPC203468) NP level
NCT03088345 Early Use of Vasopressin in Post-Fontan Management congenital heart disease Arginine (NPC226453) NP level
NCT04750902 A Clinical Trial to Assess the Safety and the Anti-caries Efficacy of COL 101 (Arginine) Non-fluoride Dentifrices in Comparison With 0.24% Sodium Fluoride (1100 Ppm F) Dentifrice Control in 10 to 14-year-old Children dental caries Arginine (NPC226453) NP level
NCT05210504 Determinants of Alpha-aminoadipic Acid (2-AAA) and Relationship to Diabetes: Study 3 type 2 diabetes mellitus Lysine (NPC112890) NP level
NCT00376948 Genistein, Gemcitabine, and Erlotinib in Treating Patients With Locally Advanced or Metastatic Pancreatic Cancer pancreatic carcinoma Genistein (NPC39426) NP level
NCT03418935 Remaxol® in Mechanical Jaundice of Non-malignant Origin obstructive jaundice Methionine (NPC152451) NP level
NCT00345813 Soy Supplements in Treating Patients Undergoing Surgery for Localized Prostate Cancer prostate cancer Isoflavone (NPC201284) NP level
NCT05457959 Peptide-Pulsed Dendritic Cell Vaccination in Combination With Nivolumab and Ipilimumab for the Treatment of Recurrent and/or Progressive Diffuse Hemispheric Glioma, H3 G34-mutant glioma Lysine (NPC112890) NP level
NCT00677339 L-arginine and Vitamin D Adjunctive Therapy in Pulmonary Tuberculosis (TB) pulmonary tuberculosis Arginine (NPC226453) NP level
NCT02612259 A Phase II, Randomized, Double-blind, Placebo-controlled, in Parallel Groups Clinical Trial to Assess the Safety and Efficacy of Dietary Supplementation With Tryptophan to Achieve Weight Loss, and Its Neuropsychological Effects in Adolescents With Obesity obesity Tryptophan (NPC203468) NP level
NCT03679780 The Effect of Endothelin and L-Arginine on Racial Differences in Vasoconstriction cardiovascular disease Arginine (NPC226453) NP level
NCT01325311 Cholecalciferol and Genistein Before Surgery in Treating Patients With Early Stage Prostate Cancer prostate adenocarcinoma Genistein (NPC39426) NP level
NCT00905723 The Effects of Isoflavone and Estrogen in Sex Response in Climacteric Women menopause Isoflavone (NPC201284) NP level
NCT00056433 Evaluation of Hydroxyurea Plus L-arginine or Sildenafil to Treat Sickle Cell Anemia sickle cell anemia Arginine (NPC226453) NP level
NCT03359239 Atezolizumab Given in Combination With a Personalized Vaccine in Patients With Urothelial Cancer urinary bladder cancer Lysine (NPC112890) NP level
NCT00925639 Effects of the Concentrated Extract of Soy on Coagulation Factors After Menopause menopause Isoflavone (NPC201284) NP level
NCT03446456 Vasopressin and Pain Perception in the Brain pain Arginine (NPC226453) NP level
NCT02427581 Safety and Immunogenicity of a Personalized Synthetic Long Peptide Breast Cancer Vaccine Strategy in Patients With Persistent Triple-Negative Breast Cancer Following Neoadjuvant Chemotherapy triple-negative breast cancer Lysine (NPC112890) NP level
NCT02075112 Soy Isoflavone in Combination With Radiation Therapy and Cisplatin in SCC of the Head and Neck head and neck malignant neoplasia Isoflavone (NPC201284) NP level
NCT02567799 BIO 300 Non-Small Cell Lung Cancer Study non-small cell lung carcinoma Genistein (NPC39426) NP level
NCT00016744 Phenylbutyrate/Genistein Duotherapy in Delta F508-Homozygous(for Cystic Fibrosis) cystic fibrosis Genistein (NPC39426) NP level
NCT01439555 Endothelial Facilitation in Alzheimer's Disease Alzheimer disease Arginine (NPC226453) NP level
NCT04201873 Pembrolizumab and a Vaccine (ATL-DC) for the Treatment of Surgically Accessible Recurrent Glioblastoma glioblastoma multiforme Lysine (NPC112890) NP level
NCT03166254 Personalized Therapeutic Anti-tumor Vaccine With Pembrolizumab and Standard of Care Chemotherapy in Squamous Non-Small Cell Lung Cancer and Extensive Stage Small Cell Lung Cancer non-small cell lung carcinoma Lysine (NPC112890) NP level
NCT02756117 The Effect of Acute Lysine Administration on α-aminoadipic Acid prediabetes syndrome Lysine (NPC112890) NP level
NCT01890070 Study of the Nutraceutical Properties and Health Benefits of Traditional Components of the Mediterranean Diet Obesity Castanea Sativa Plant level
As single plant
NCT04764383 Histaminergic Basis of Fatigue in Multiple Sclerosis multiple sclerosis Histidine (NPC237812) NP level
NCT03068832 Neoepitope-based Personalized Vaccine Approach in Pediatric Patients With Recurrent Brain Tumors brain neoplasm Lysine (NPC112890) NP level
NCT05281926 A Phase I, Open-label Study to Assess the Safety and Efficacy of Poly-ICLC Plus Nivolumab in Unresectable Hepatocellular Carcinoma Patients hepatocellular carcinoma Lysine (NPC112890) NP level
NCT00345150 Effects of Inhibition of NO-Synthesis on Renal Hemodynamics and Sodium Excretion in Patients With Essential Hypertension and Healthy Controls hypertension Arginine (NPC226453) NP level
NCT03162562 The Safety and Antitumor Activity of the Combination of Oregovomab and Hiltonol in Recurrent Advanced Ovarian Cancer ovarian carcinoma Lysine (NPC112890) NP level
NCT00974714 L-arginine Effects on Chronic Hypertension in Pregnancy preeclampsia Arginine (NPC226453) NP level
NCT00133562 HIAS II - Study of Nutritional Supplementation in Hospitalized Children With Persistent Diarrhea or Malnutrition malnutrition Glycine (NPC126681) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 GRIA2,GRIK3,SLC1A1,ESRRB,ESR1,TSHR,GRM1,GRIK5,ESRRA
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 GRIK3,GRM8,LMNA,SLC1A1,DPP4,BLM,OR51E2,CYP2C9,MAOB
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 EGFR,ESR2,ESR1
 NCT02427581,NCT00244933,NCT00290758,NCT00513916,NCT00986609
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 GRM5,MAOB,ESR2,GRM3,GRM2,MAPT
 NCT01439555,NCT04740580
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 GRIN2B,GRIA1,GRIA3,GRIA4,MAPT,MAOB,GRIA2,GRM5
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 ESR2,LMNA,GRM5,MAPT,GRIK5,BLM,OR51E2,GRM2
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 GRM8,GRM5,CYP2C9,GRIK3,GRIA4,GRM8,TSHR,OR51E2
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 CYP3A4,ESRRB,NFKB1,ESRRA,ESR1,AOX1,EGFR
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 SLC1A1,LMNA,AOX1,DPP4,OR51E2,GRIK1,EGFR
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 GRIK3,LMNA,ESRRB,GRM5,GRM1,GRIA1,EGFR
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 ESRRB,NFKB1,DPP4,MAPT,CYP3A4,CYP2C9,GRIK1
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 GRIN2B,GRIN1,NFKB1,ESR1
 NCT03266965,NCT04764383
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 GRIA2,GRM3,GRM1,BLM,OR51E2,GRIA1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 GRIA2,TSHR,GRM1,BLM,OR51E2,CYP2C9
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 GRIA2,MAPT,BLM,OR51E2,GRM2,MAPT
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 GRIK3,LMNA,DPP4,TSHR,BLM,AOX1
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 GRIK3,CYP3A4,GRIK1,GRIA1,ESRRA,GRM2
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 SLC1A1,DPP4,GRM1,CYP3A4,BLM,OR51E2
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 GRIA4,GRIA2,GRIN2B,GRIA3,GRIA1
Dissociative neurological symptom disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B60
 GRIA1,GRIK1,GRIN2B,GRIN1,GRIN2A
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 DPP4,NFKB1
 NCT02744820,NCT05210504,NCT02440061
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 OR51E2,GRIN3A
 NCT01325311,NCT00546039,NCT01126879
Sickle-cell disorder
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A51
 NCT02447874,NCT00513617,NCT01142219,NCT05470998,NCT00056433
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 GRIK3,GRM8,ESRRB,BLM,CYP2C9
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 GRIA2,GRM8,SLC1A1,ESR1,BLM
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 SLC1A1,DPP4,BLM,CYP2C9,ESRRA
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 ESRRB,AOX1,ESR1,DPP4,OR51E2
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 GRM2,GRM3
 NCT01890070
 NCT02612259
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 ESRRB,CYP3A4,NFKB1,ESRRA
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 MAOB
 NCT03166228,NCT00223717,NCT00345150
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 ESRRA,ESRRB
 NCT01501942,NCT00280683
Depression
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A70-6A7Z
 GRIN2B,MAOB,GRM2,GRM3
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 NFKB1,ESRRA,DPP4,ESRRB
Non-small cell lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 EGFR
 NCT02567799,NCT03166254,NCT01628471
Cystic fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA25
 NCT01417481,NCT00405665,NCT00016744,NCT00590538
Menopause
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA30.0
 NCT00925639,NCT00235924,NCT00179556,NCT00905723
Neoplasms
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 02
 NCT01191216,NCT00567931,NCT01324115,NCT01920191
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 DPP4,TSHR,BLM,GRIN3A
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 NFKB1,DPP4,GRM1,GRIN3A
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 GRIK3,SLC1A1,GRM8,GRM5
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 LMNA,DPP4,GRIK1,ESRRB
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 GRM8,ESRRB,CYP2C9,ESR2
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 TSHR,GRIK5,BLM,CYP2C9
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 GRM5,GRIN3A,GRIA4,BLM
Anxiety
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB24.3
 GRM2,CYP3A4,GRM5
Breast in situ carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2E65
 ESR1
 NCT03606967,NCT04616248
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 NFKB1,MAPT
 NCT01842139
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 DPP4
 NCT01664650,NCT00541710
Malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F40-1F45
 MAOB
 NCT00147368,NCT00616304
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 DPP4,ESR1,NFKB1
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 GRIK1
 NCT01796678,NCT03446456
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 ESRRA,NFKB1
 NCT04535427
Epilepsy/seizure
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A61-8A6Z
 GRIK1,GRM2,GRIN2B
Vasomotor/allergic rhinitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA08
 ESR2,ESRRA,ESRRB
Hepatocellular carcinoma, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH4W48
 NCT02586285,NCT05281926,NCT01287585
Malignant neoplasm of pancreas, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.Z
 NCT00376948,NCT00882765,NCT03956056
Glioblastoma, primary, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH0MB1
 NCT02017249,NCT04201873,NCT00262730
Pre-eclampsia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA24
 NCT00974714,NCT00157521,NCT00571766
Myelodysplastic syndromes, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A3Z
 CYP2C9,GRIK1,TSHR
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 GRIK1,GRIA2,GRM3
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 ESRRB,GRM1,GRIA1
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CYP3A4,BLM,CYP2C9
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 GRIK3,GRIA2,DPP4
Cardiac arrest
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MC82
 GRIN2B
 NCT03640949
General pain disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E43
 MAOB,GRIK1
Postoperative inflammation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-CA43
 ESRRA,ESRRB
Eyelid inflammatory disorder
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A02
 ESRRA,ESRRB
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 GRIN1,CYP2C9
Muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70
 NFKB1,MAOB
Hepatitis virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E50-1E51
 ESR2,EGFR
Skin disease
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA00-EM0Z
 ESRRB,ESRRA
Obsessive-compulsive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6B20
 GRIN1
 NCT01031927
Head and neck cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D42
 EGFR
 NCT02075112
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 NFKB1,ESR2
Contact dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EK00-EK0Z
 ESRRB,ESRRA
Autism spectrum disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02
 DPP4,GRM5
Inflammatory arthropathy
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA2Z
 ESRRB,ESRRA
Chronic pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG30
 GRIN2B,EGFR
Choreiform disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A01
 NFKB1,MAPT
Psychotic disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20-6A25
 GRM3,GRM2
Bipolar disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A60
 GRM2
 NCT01720316
Menopausal disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA30
 ESR2,ESR1
Sepsis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G40-1G41
 ESR2
 NCT01263041
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 ESR1,ESR2
Irritable bowel syndrome
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD91
 NFKB1
 NCT04364750
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 EGFR
 NCT01985763
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 EGFR
 NCT01783431
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 ESR1,EGFR
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 EGFR
 NCT00917826
Structural developmental anomaly of heart or great vessels, unspecified
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA8Z
 NCT03088345,NCT02618824
Hepatic fibrosis/cirrhosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB93
 NCT00344916,NCT00005107
Dental caries
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA08.0
 NCT04750902,NCT02388178
coronary artery disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA8Y-BA8Z
 NCT00287690,NCT00134433
Primary neoplasms of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 NCT03068832,NCT01188096
Schizoaffective disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A21
 NCT00222235,NCT00575848
Malignant neoplasms of bladder, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.Z
 NCT03359239,NCT01489813
Central nervous system disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A04-8D87
 NCT00058123,NCT00052715
Chronic kidney disease
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB61
 NCT00047983,NCT00029796
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 NCT00408577,NCT03679780
Unspecified undernutrition
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B7Z
 NCT00133562,NCT00338221
Noise effects on inner ear
Disease Category: 10.Diseases of the ear or mastoid process
Disease ICD-11 Code: AB37
 NCT01345474,NCT02903355
Duchenne muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70.1
 NCT01388764,NCT02516085
COVID-19
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D6Y
 NCT04631536,NCT04703036
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 GRM8,BLM
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 GRM1,GRM8
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 ESRRB,SLC1A1
Dilated cardiomyopathy
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC43.0
 GRM1,GRM8
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 ESRRA,GRM5,GRM2,GRM3
 NCT00291226,NCT00005658,NCT02067975,NCT00929370,NCT00000372,NCT00268749,NCT00222235,NCT00276263,NCT04054973,NCT00575848
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 GRIA2,GRIA4,OR51E2,GRIK5,BLM,GRIN3A,GRIK3,GRM8,MAPT,GRM2,SLC1A1,GRM1,GRIK1,GRIA1
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 AOX1,ESR2,MAOB,ESR1
 NCT00058266,NCT00005827,NCT02766478,NCT00584532,NCT00078923,NCT01607879,NCT00345813,NCT00596895
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 GRIK3,GRIA4,ESRRB,GRM8,DPP4,TSHR,GRM3,ESRRA,GRM1,GRIK1,GRIA1,GRIN3A
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 ESR2,GRIK3,GRM8,EGFR,LMNA,AOX1,TSHR,BLM,OR51E2,GRIN3A,MAOB
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 EGFR
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 DPP4
HIV-infected patients with tuberculosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1B10-1B14
 GRIN1
Endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10
 ESR1
Low bone mass disorder
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83
 ESR1
Metastatic tumour
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D50-2E2Z
 ESR1
Nasopharyngeal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6B
 EGFR
Skin and skin-structure infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F28-1G0Z
 NFKB1
Adrenal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 ESR1
Mood disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A60-6E23
 GRM5
Prostate hyperplasia
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA90
 ESR2
Migraine
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A80
 MAOB
Acute/subacute hepatic failure
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB91
 NFKB1
Female genital tract noninflammatory disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA1Y
 ESR1
Dyspareunia
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA12
 ESR1
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 DPP4
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 EGFR
Fungal infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F29-1F2F
 NFKB1
Urethral cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C93
 EGFR
Metastatic lymph node neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60
 EGFR
Alpha-1-antitrypsin deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C5A
 GRIN2B
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 EGFR
Unspecific body region injury
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: ND56
 EGFR
Acquired hypomelanotic disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED63
 MAOB
Female pelvic pain
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA34
 ESR1
Thyroid cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10
 TSHR
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 DPP4
Acquired prion disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E01
 ESR1
Nutritional deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B50-5B71
 GRIN2A
Metastatic biliary tract neoplasms
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C14-2C17
 EGFR
Primary psychotic disorder manifestation
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A25
 MAOB
Hypopharyngeal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6D
 EGFR
Unspecified viral infection of unspecified site
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D9Z
 ESR1
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 EGFR
Skin cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30-2C37
 MAOB
Cerebral ischaemic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B11
 GRIN2B
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 GRIK1
Lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40
 NFKB1
Skeletal anomaly
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD24
 ESR1
Spinal cord/cranial nerve neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A02
 EGFR
Cushing syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A70
 ESR2
Degenerative high myopia
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B76
 ESRRA
Diabetic foot ulcer
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD54
 EGFR
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 DPP4
Skin tag/polyp
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EK71
 MAOB
Testicular cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80
 EGFR
Vitamin deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B55-5B5F
 AOX1
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 EGFR
Intracerebral haemorrhage
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B00
 EGFR
Menstrual cycle bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20
 ESR1
Tonus and reflex abnormality
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB47
 GRM5
Female infertility
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA31
 ESR1
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 EGFR
Nausea/vomiting
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD90
 MAOB
Pituitary gland disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A60-5A61
 ESR1
Ischemia
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B10-8B11
 EGFR
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 EGFR
Mature B-cell leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A82
 EGFR
Male infertility
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB04
 ESR1
Skin sensation disturbance
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: ME65
 GRM5
Hypo-thyroidism
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A00
 TSHR
Fragile X chromosome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD55
 GRM5
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 MAPT
Colon cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90
 EGFR
Mental/behavioural/neurodevelopmental disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6E20-6E8Z
 GRM2
Vaginitis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA02
 ESR1
Malignant mesenchymal neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B5D-2B5Y
 EGFR
Acne vulgaris
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED80
 ESR1
Skin postprocedural disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EL8Y
 EGFR
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 MAOB
Chronic hepatitis C
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E51.1
 NCT00475176
Essential hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00
 NCT00137124
Alcoholic hepatitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB94.1
 NCT00200746
Congestive heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10
 NCT00344734
Glioma, malignant
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH4RQ3
 NCT05457959
Neoplasms of unknown behaviour of urinary organs
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F98
 NCT00118040
Carcinoma of male breast
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH5KW8
 NCT01042535
Argininosuccinic aciduria
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50.A0
 NCT00345605
Cutaneous T-cell lymphoma, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH1951
 NCT02061449
Acute myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41
 NCT02929888
Inflammatory carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C62
 NCT00986609
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 NCT05025488
Myelofibrosis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A22
 NCT05025488
Unspecified malignant neoplasms of unspecified sites
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D4Z
 NCT00001696
Malignant neoplasms of colon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90
 NCT01985763
Osteoporosis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83.1
 NCT00010686
Rectum cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B92
 NCT01985763
Liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB90-DB10Z
 NCT00573313
Periodontal disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA0C
 NCT05042024
Acute viral hepatitis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E50
 NCT00108589
Infectious gastroenteritis or colitis without specification of infectious agent
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A40.Z
 NCT00133406
Carcinomas of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.0
 NCT03162562
Melanoma of skin, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30.Z
 NCT02129075
Small cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.1
 NCT01266018
Galactose-1-phosphate uridyltransferase deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C51.40
 NCT03580122
Intermediate hyperglycaemia, unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A40.Z
 NCT02756117
Obstruction of bile duct
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DC10.02
 NCT03418935
Melasma
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED60.1
 NCT01603446
Cocaine use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C45
 NCT00000324
Adenocarcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D40
 NCT01958372
Flare or flash
Disease Category: X.Extension Codes
Disease ICD-11 Code: XE03F
 NCT01140646
Ependymoma, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH1511
 NCT02125786
Rhabdomyosarcoma, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH0GA1
 NCT01871766
Beta thalassaemia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3A50.2
 NCT00006136
Circadian rhythm sleep disorder
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A60-7A65
 NCT01468038
Other specified disorders of carbohydrate absorption or transport
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C61.Y
 NCT02291458
Pulmonary alveolar proteinosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB04.31
 NCT03887169
Pleural mesothelioma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26
 NCT04345705
Craniopharyngioma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH1AZ2
 NCT01419067
Abdominal pelvic pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MD81
 NCT00694564
Symptoms and signs involving cognition, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB21.Z
 NCT03493178
Tuberculosis of the respiratory system
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1B10
 NCT00677339
Allergic/hypersensitivity disorder
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A80-4A8Z
 NCT04249336
Chronic arterial occlusive disease, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 NCT03861416
Idiopathic pulmonary fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03.4
 NCT04482595
Severe acute respiratory syndrome
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D65
 NCT04482595
Follicular lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A80
 NCT03121677
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 GRIN3A
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 TSHR
Inflammatory bowel diseases, unspecified
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD7Z
 GRIN3A
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 GRM8
Pneumonia due to Pseudomonasaeruginosa
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.05
 DPP4
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 BLM
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 GRM2

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group