• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Centaurea Calcitrapa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGATGCCTGCACAGCAGAACGACCCGTGAACATGTAAATCACAATCGGGTGTCGTGGGATACGGCGCAAGCCTTTGCCCTGCGATGCTTGCTGTCATGCGTTCAAGGTGCCTGTCTAGGCATCGTGGGCGTTTTGTCGGCACAAAAACAAAACCCCGGCACGGCATGTGCCAAGGAAAACAAAACTCAAGAAGGGTCCGTCTCGTGTTGCCCCGTTTTTGGTGTGCACGCGGGTCGTGGCCTCTCATTAACCATAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO13438
Plant Latin Name: Centaurea Calcitrapa
Taxonomy Genus: Centaurea
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 41511
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; India; Italy

Traditional Medicine System:
Indian Folk


Medicinal Functions:

Diuretic

Geographical Distribution

Turkey; Italy; India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

44 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


28 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

27 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9874

Ingredient ID: NPC98143

Ingredient ID: NPC93843

Ingredient ID: NPC75428

Ingredient ID: NPC71853

Ingredient ID: NPC7180

Ingredient ID: NPC71506

Ingredient ID: NPC6323

Ingredient ID: NPC57788

Ingredient ID: NPC44193

Ingredient ID: NPC37733

Ingredient ID: NPC37250

Ingredient ID: NPC34770

Ingredient ID: NPC310175

Ingredient ID: NPC302939

Ingredient ID: NPC281131

Ingredient ID: NPC27184

Ingredient ID: NPC271215

Ingredient ID: NPC269800

Ingredient ID: NPC253754

Ingredient ID: NPC246519

Ingredient ID: NPC241055

Ingredient ID: NPC235076

Ingredient ID: NPC230301

Ingredient ID: NPC225680

Ingredient ID: NPC225434

Ingredient ID: NPC216630

Ingredient ID: NPC20791

Ingredient ID: NPC184014

Ingredient ID: NPC182432

Ingredient ID: NPC177684

Ingredient ID: NPC176740

Ingredient ID: NPC173637

Ingredient ID: NPC167539

Ingredient ID: NPC151327

Ingredient ID: NPC14234

Ingredient ID: NPC14213

Ingredient ID: NPC139546

Ingredient ID: NPC132669

Ingredient ID: NPC131417

Ingredient ID: NPC126029

Ingredient ID: NPC118284

Ingredient ID: NPC103123

Ingredient ID: NPC10146