• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Schizanthus Tricolor


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AAGGATCATTGTCGAAACCTCCAAAACCAGANGAACCCGCGAACTNGTATAAAACGCGAGGGAGGGGAGCGGACGGGTGCCTTCTGCGCCCCATCCGCGCCAGCTCCCTCTTCTCCGGCGCGCGCCCCGTGCGCGCTCCGGGGCAACAACGAACCCCGGCGCGGAAAGCGCCCAAGGAATACTCAACGAAGAGCCTGCCTCGCGCGCCCCGTTCGCGGCCAGCGCGGGAGGATCTGTGCTTCTTTTAAACATTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCGCACACCGCAAGGTGATTCGCGTGGGACGGAAATTGGCCTCCCGTGNNCCTCNAGGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGTAACCCAACTCGCGTCGTGCCGTGACAACGTCCTGTCGCTCGTTTGTTCTCCACGACCCTTCAAGCGCTTCGGCGCTTCGACCGCGACCCCAGGT

Click for details-----ITS1

AAGGATCATTGTCGAAACCTCCAAAACCAGANGAACCCGCGAACTNGTATAAAACGCGAGGGAGGGGAGCGGACGGGTGCCTTCTGCGCCCCATCCGCGCCAGCTCCCTCTTCTCCGGCGCGCGCCCCGTGCGCGCTCCGGGGCAACAACGAACCCCGGCGCGGAAAGCGCCCAAGGAATACTCAACGAAGAGCCTGCCTCGCGCGCCCCGTTCGCGGCCAGCGCGGGAGGATCTGTGCTTCTTTTAAACATTAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCGCACACCGCAAGGTGATTCGCGTGGGACGGAAATTGGCCTCCCGTGNNCCTCNAGGCGCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGGCAAGTGGTGGTTGTAACCCAACTCGCGTCGTGCCGTGACAACGTCCTGTCGCTCGTTTGTTCTCCACGACCCTTCAAGCGCTTCGGCGCTTCGACCGCGACCCCAGGT
Taxonomic Information

Plant ID: NPO13379
Plant Latin Name: Schizanthus Tricolor
Taxonomy Genus: Schizanthus
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 360636
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

131 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


102 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

73 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC91115

Ingredient ID: NPC89630

Ingredient ID: NPC89299

Ingredient ID: NPC87125

Ingredient ID: NPC84694

Ingredient ID: NPC81010

Ingredient ID: NPC78540

Ingredient ID: NPC78107

Ingredient ID: NPC76849

Ingredient ID: NPC76286

Ingredient ID: NPC75455

Ingredient ID: NPC71303

Ingredient ID: NPC70744

Ingredient ID: NPC69101

Ingredient ID: NPC65628

Ingredient ID: NPC62928

Ingredient ID: NPC62107

Ingredient ID: NPC60103

Ingredient ID: NPC55412

Ingredient ID: NPC50898

Ingredient ID: NPC488012

Ingredient ID: NPC488011

Ingredient ID: NPC488010

Ingredient ID: NPC488009

Ingredient ID: NPC488008

Ingredient ID: NPC44079

Ingredient ID: NPC43521

Ingredient ID: NPC43143

Ingredient ID: NPC36002

Ingredient ID: NPC327905

Ingredient ID: NPC32203

Ingredient ID: NPC320375

Ingredient ID: NPC319318

Ingredient ID: NPC31618

Ingredient ID: NPC312501

Ingredient ID: NPC304079

Ingredient ID: NPC303141

Ingredient ID: NPC302857

Ingredient ID: NPC296682

Ingredient ID: NPC294941

Ingredient ID: NPC294902

Ingredient ID: NPC289459

Ingredient ID: NPC289116

Ingredient ID: NPC28862

Ingredient ID: NPC284424

Ingredient ID: NPC279989

Ingredient ID: NPC278068

Ingredient ID: NPC277460

Ingredient ID: NPC274692

Ingredient ID: NPC273700

Ingredient ID: NPC272149

Ingredient ID: NPC270165

Ingredient ID: NPC268846

Ingredient ID: NPC268381

Ingredient ID: NPC263386

Ingredient ID: NPC260952

Ingredient ID: NPC259903

Ingredient ID: NPC255906

Ingredient ID: NPC255392

Ingredient ID: NPC255042

Ingredient ID: NPC253671

Ingredient ID: NPC25325

Ingredient ID: NPC250527

Ingredient ID: NPC245561

Ingredient ID: NPC244231

Ingredient ID: NPC243677

Ingredient ID: NPC243289

Ingredient ID: NPC243083

Ingredient ID: NPC242580

Ingredient ID: NPC241838

Ingredient ID: NPC234133

Ingredient ID: NPC23265

Ingredient ID: NPC231772

Ingredient ID: NPC23077

Ingredient ID: NPC230301

Ingredient ID: NPC229415

Ingredient ID: NPC224389

Ingredient ID: NPC22105

Ingredient ID: NPC212938

Ingredient ID: NPC211466

Ingredient ID: NPC209945

Ingredient ID: NPC209719

Ingredient ID: NPC208183

Ingredient ID: NPC206341

Ingredient ID: NPC206095

Ingredient ID: NPC205081

Ingredient ID: NPC203719

Ingredient ID: NPC199931

Ingredient ID: NPC192744

Ingredient ID: NPC189444

Ingredient ID: NPC187770

Ingredient ID: NPC187432

Ingredient ID: NPC184536

Ingredient ID: NPC183154

Ingredient ID: NPC182840

Ingredient ID: NPC179984

Ingredient ID: NPC179309

Ingredient ID: NPC174586

Ingredient ID: NPC172563

Ingredient ID: NPC172231

Ingredient ID: NPC17192

Ingredient ID: NPC170546

Ingredient ID: NPC16651

Ingredient ID: NPC165967

Ingredient ID: NPC158675

Ingredient ID: NPC156654

Ingredient ID: NPC154831

Ingredient ID: NPC153724

Ingredient ID: NPC152042

Ingredient ID: NPC150648

Ingredient ID: NPC145977

Ingredient ID: NPC145879

Ingredient ID: NPC143765

Ingredient ID: NPC143182

Ingredient ID: NPC13818

Ingredient ID: NPC136840

Ingredient ID: NPC135452

Ingredient ID: NPC134847

Ingredient ID: NPC134525

Ingredient ID: NPC130396

Ingredient ID: NPC127447

Ingredient ID: NPC127332

Ingredient ID: NPC122828

Ingredient ID: NPC121619

Ingredient ID: NPC119631

Ingredient ID: NPC110693

Ingredient ID: NPC106770

Ingredient ID: NPC10476

Ingredient ID: NPC103213

Ingredient ID: NPC10283

Ingredient ID: NPC10052