• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Illicium Verum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAGGACCCACTAGGCTAACCGGCGAACTTGTCACATCATTCTTGGGGGTGATGGGAATGTCCTTCGGGGCCCTAGATACCCTCCTCCCCCTCCCTTGGTTCTTGCTCTTTTATCGATGGTCCCTTGAGGAGTAGAGAAACATGGGAGGGTGGGAACAACCAACATCGGCGCGGCATGCGTCAAGTAATCACGAACGGAATAAGGCACCTCCTCTGCAGAGGTGGTGCTGTAGACCCGAATAAAATCAGAGATGACTCTCGGCAACGGATATCTAGGCTCTTGCCACGATGAAGAACGTAGCCAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCAAGTTTTTGAACGCAAGTTGCSCCCGAGGCCACCAGGCCAAGGGCACGCCTGCCTGGGCGTCACGCTTTGCGTCGCTCCCCCACCTCCTTGCCCATACGGGCTCTGTGGTGTTAAGGGGAAGCGGAGATTGGCTGCCCGTGCCATGGTTGCGTGGCCAGCCGAAAAGTGGGCCTCTGGGCGTGTTGCGACACGACGAGTGGTGGTCAAATACCCTTCTCATCGCATGGGACGTCGAGTCGCTTTGCTAGTGGCACAAGAACTCTTGGAGCCGTTTCGCGGCAACCTGCA

Click for details-----ITS1

NA

Click for details-----ITS2

TTTGCGTCGCTCCCCCACCTCCTTGCCCATACGGGCTCTGTGGTGTTAAGGGGAAGCGGAGATTGGCTGCCCGTGCCATGGTTGCGTGGCCAGCCGAAAAGTGGGCCTCTGGGCGTGTTGCGACACGACGAGTGGTGGTCAAATACCCTTCTCATCGCATGGGACGTCGAGTCGCTTTGCTAGTGGCACAAGAACTCTTGGAGCCGTTTCGCGGCAACCTGCA
Taxonomic Information

Plant ID: NPO13274
Plant Latin Name: Illicium Verum
Taxonomy Genus: Illicium
Taxonomy Family: Schisandraceae

Plant External Links:

NCBI TaxonomyDB: 124778
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; Jordan; India; Vietnam; China

Traditional Medicine System:
TCM; Ayurveda; Siddha


Medicinal Functions:

Antibacterial; Appetizer; Carminative; Expectorant; Homeopathy; Stimulant

Geographical Distribution

India; Jordan; China; Vietnam; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

239 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


212 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

101 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC99734

Ingredient ID: NPC99480

Ingredient ID: NPC95675

Ingredient ID: NPC94632

Ingredient ID: NPC93345

Ingredient ID: NPC91574

Ingredient ID: NPC89798

Ingredient ID: NPC88566

Ingredient ID: NPC85871

Ingredient ID: NPC8574

Ingredient ID: NPC85550

Ingredient ID: NPC83028

Ingredient ID: NPC82770

Ingredient ID: NPC80807

Ingredient ID: NPC8002

Ingredient ID: NPC79913

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC7491

Ingredient ID: NPC74188

Ingredient ID: NPC72074

Ingredient ID: NPC71853

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC71327

Ingredient ID: NPC68889

Ingredient ID: NPC67761

Ingredient ID: NPC67037

Ingredient ID: NPC66655

Ingredient ID: NPC66577

Ingredient ID: NPC65517

Ingredient ID: NPC64176

Ingredient ID: NPC62765

Ingredient ID: NPC61779

Ingredient ID: NPC61769

Ingredient ID: NPC60556

Ingredient ID: NPC60555

Ingredient ID: NPC60427

Ingredient ID: NPC60288

Ingredient ID: NPC58970

Ingredient ID: NPC57879

Ingredient ID: NPC57877

Ingredient ID: NPC5640

Ingredient ID: NPC52230

Ingredient ID: NPC51758

Ingredient ID: NPC51114

Ingredient ID: NPC490331

Ingredient ID: NPC489890

Ingredient ID: NPC47844

Ingredient ID: NPC4718

Ingredient ID: NPC45727

Ingredient ID: NPC44489

Ingredient ID: NPC43728

Ingredient ID: NPC40020

Ingredient ID: NPC39633

Ingredient ID: NPC39068

Ingredient ID: NPC38209

Ingredient ID: NPC3649

Ingredient ID: NPC36408

Ingredient ID: NPC36108

Ingredient ID: NPC36027

Ingredient ID: NPC34764

Ingredient ID: NPC3444

Ingredient ID: NPC32670

Ingredient ID: NPC315

Ingredient ID: NPC31279

Ingredient ID: NPC310905

Ingredient ID: NPC309982

Ingredient ID: NPC309182

Ingredient ID: NPC307216

Ingredient ID: NPC306988

Ingredient ID: NPC306647

Ingredient ID: NPC305205

Ingredient ID: NPC303740

Ingredient ID: NPC303621

Ingredient ID: NPC301043

Ingredient ID: NPC300017

Ingredient ID: NPC29883

Ingredient ID: NPC298266

Ingredient ID: NPC298224

Ingredient ID: NPC297643

Ingredient ID: NPC296337

Ingredient ID: NPC294902

Ingredient ID: NPC294136

Ingredient ID: NPC290078

Ingredient ID: NPC289475

Ingredient ID: NPC289366

Ingredient ID: NPC288932

Ingredient ID: NPC288411

Ingredient ID: NPC287335

Ingredient ID: NPC287331

Ingredient ID: NPC286774

Ingredient ID: NPC284927

Ingredient ID: NPC281387

Ingredient ID: NPC279404

Ingredient ID: NPC277907

Ingredient ID: NPC276222

Ingredient ID: NPC275335

Ingredient ID: NPC275255

Ingredient ID: NPC274494

Ingredient ID: NPC27184

Ingredient ID: NPC271527

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC267649

Ingredient ID: NPC26600

Ingredient ID: NPC264400

Ingredient ID: NPC264288

Ingredient ID: NPC263222

Ingredient ID: NPC261501

Ingredient ID: NPC26111

Ingredient ID: NPC260773

Ingredient ID: NPC25978

Ingredient ID: NPC259654

Ingredient ID: NPC259138

Ingredient ID: NPC259134

Ingredient ID: NPC258672

Ingredient ID: NPC25836

Ingredient ID: NPC258171

Ingredient ID: NPC257451

Ingredient ID: NPC257190

Ingredient ID: NPC254156

Ingredient ID: NPC252222

Ingredient ID: NPC251306

Ingredient ID: NPC249815

Ingredient ID: NPC247266

Ingredient ID: NPC246165

Ingredient ID: NPC245858

Ingredient ID: NPC2415

Ingredient ID: NPC241110

Ingredient ID: NPC23903

Ingredient ID: NPC233209

Ingredient ID: NPC233077

Ingredient ID: NPC232881

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC23145

Ingredient ID: NPC229403

Ingredient ID: NPC229262

Ingredient ID: NPC227670

Ingredient ID: NPC226716

Ingredient ID: NPC222001

Ingredient ID: NPC220540

Ingredient ID: NPC216630

Ingredient ID: NPC215632

Ingredient ID: NPC215012

Ingredient ID: NPC214691

Ingredient ID: NPC214321

Ingredient ID: NPC213842

Ingredient ID: NPC213749

Ingredient ID: NPC212421

Ingredient ID: NPC209705

Ingredient ID: NPC209279

Ingredient ID: NPC209275

Ingredient ID: NPC20674

Ingredient ID: NPC204932

Ingredient ID: NPC204171

Ingredient ID: NPC202189

Ingredient ID: NPC201747

Ingredient ID: NPC19890

Ingredient ID: NPC198658

Ingredient ID: NPC197581

Ingredient ID: NPC194586

Ingredient ID: NPC193812

Ingredient ID: NPC191697

Ingredient ID: NPC190810

Ingredient ID: NPC189853

Ingredient ID: NPC189771

Ingredient ID: NPC188501

Ingredient ID: NPC188238

Ingredient ID: NPC184049

Ingredient ID: NPC181365

Ingredient ID: NPC180871

Ingredient ID: NPC177988

Ingredient ID: NPC177112

Ingredient ID: NPC176589

Ingredient ID: NPC176326

Ingredient ID: NPC175987

Ingredient ID: NPC175737

Ingredient ID: NPC168855

Ingredient ID: NPC168829

Ingredient ID: NPC168596

Ingredient ID: NPC16737

Ingredient ID: NPC166692

Ingredient ID: NPC166362

Ingredient ID: NPC16525

Ingredient ID: NPC164958

Ingredient ID: NPC16157

Ingredient ID: NPC161097

Ingredient ID: NPC159312

Ingredient ID: NPC156769

Ingredient ID: NPC156654

Ingredient ID: NPC156290

Ingredient ID: NPC154486

Ingredient ID: NPC151620

Ingredient ID: NPC150329

Ingredient ID: NPC146289

Ingredient ID: NPC144023

Ingredient ID: NPC143639

Ingredient ID: NPC141777

Ingredient ID: NPC140956

Ingredient ID: NPC13991

Ingredient ID: NPC139576

Ingredient ID: NPC139546

Ingredient ID: NPC138347

Ingredient ID: NPC138306

Ingredient ID: NPC138113

Ingredient ID: NPC13789

Ingredient ID: NPC13755

Ingredient ID: NPC137153

Ingredient ID: NPC13630

Ingredient ID: NPC131769

Ingredient ID: NPC130849

Ingredient ID: NPC12987

Ingredient ID: NPC126825

Ingredient ID: NPC125793

Ingredient ID: NPC125564

Ingredient ID: NPC121322

Ingredient ID: NPC119949

Ingredient ID: NPC119039

Ingredient ID: NPC118636

Ingredient ID: NPC115723

Ingredient ID: NPC114764

Ingredient ID: NPC114239

Ingredient ID: NPC114209

Ingredient ID: NPC109875

Ingredient ID: NPC109813

Ingredient ID: NPC108872

Ingredient ID: NPC108494

Ingredient ID: NPC108441

Ingredient ID: NPC106250

Ingredient ID: NPC105246

Ingredient ID: NPC105209

Ingredient ID: NPC105094

Ingredient ID: NPC105033

Ingredient ID: NPC101285

Ingredient ID: NPC100980