• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Pinalia Stricta


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAGACCGAAATAGATCGAGTGATTCAGAGAACACGTGAACTCAGTTGTGGCAGTTGCTGTCGCATAAGATTCATCCCAGTCGTTGTCGCACCTCATATGGCGGGGCACGATTGAGGATGGATGAAACTCAAACCGGCGCAATTTCGCGCCAAGGAATTGTTAAAAAACACGAGCCCAGCGTAGGGTTTAGTGGCGTGGAGTGCTGTTGCACACCACACGGTTCTATA

Click for details-----ITS2

ATTATGTCGCTCCCTGCCAAGTCCATCTCGTCGAAGGGCGTGTCGGATGATGCTAGGATGTGGAGAGTGGCTCGTCGTGCTCATCGGTGCGGCGGGCTTAAGAGCGTGTTATCGTCTCATTGGGCCACGAACGACACGGGGTGGATACAAGCAAGCCTTCGTTGTCTCGTGCCGCCCTGAGGAATGAATTATAATAAGCCTGCGAGGTGATCCCAACCCATGCGTCGATCCGA
Taxonomic Information

Plant ID: NPO13246
Plant Latin Name: Pinalia Stricta
Taxonomy Genus: Pinalia
Taxonomy Family: Orchidaceae

Plant External Links:

NCBI TaxonomyDB: 1508133
Plant-of-the-World-Online: 651607-1

Used in Medicines

Unknown.

Geographical Distribution

Bangladesh; Myanmar; Nepal; India; Vietnam; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

56 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


23 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

28 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98777

Ingredient ID: NPC98583

Ingredient ID: NPC94583

Ingredient ID: NPC92117

Ingredient ID: NPC91409

Ingredient ID: NPC91239

Ingredient ID: NPC8651

Ingredient ID: NPC78946

Ingredient ID: NPC76128

Ingredient ID: NPC76112

Ingredient ID: NPC70622

Ingredient ID: NPC68953

Ingredient ID: NPC57380

Ingredient ID: NPC5029

Ingredient ID: NPC44260

Ingredient ID: NPC38851

Ingredient ID: NPC36959

Ingredient ID: NPC313047

Ingredient ID: NPC312929

Ingredient ID: NPC308738

Ingredient ID: NPC305843

Ingredient ID: NPC304452

Ingredient ID: NPC301384

Ingredient ID: NPC288089

Ingredient ID: NPC278329

Ingredient ID: NPC271385

Ingredient ID: NPC264145

Ingredient ID: NPC261147

Ingredient ID: NPC26080

Ingredient ID: NPC254847

Ingredient ID: NPC248949

Ingredient ID: NPC248668

Ingredient ID: NPC247364

Ingredient ID: NPC232189

Ingredient ID: NPC229036

Ingredient ID: NPC225710

Ingredient ID: NPC216752

Ingredient ID: NPC214165

Ingredient ID: NPC199875

Ingredient ID: NPC198440

Ingredient ID: NPC197087

Ingredient ID: NPC181448

Ingredient ID: NPC178851

Ingredient ID: NPC176740

Ingredient ID: NPC160512

Ingredient ID: NPC159106

Ingredient ID: NPC146973

Ingredient ID: NPC146837

Ingredient ID: NPC142811

Ingredient ID: NPC142063

Ingredient ID: NPC130315

Ingredient ID: NPC128792

Ingredient ID: NPC123953

Ingredient ID: NPC114746

Ingredient ID: NPC108455

Ingredient ID: NPC101649