CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Thalictrum Ichangense

Example Image

PLANiTS DNA barcode

ACAGCGTCGCCCCCAACCACACCCGTTGTGGGAGGGGAGCGGAGATTGGCCCCCCGAGCCCCACCGGGCACGGTCGGCACAAATGCCTGTCCCTGCTAGCGGATCGCCGCGGTCAAGTGGTGGCTTCAAATACCATTTCGGCGACCGGTTGGCGCCGCAGCCCCAGTTGGGACAGAATCGACCCGCAGAGGCCGTTCCGACGGCGTTTCACC

Taxonomic Information

Plant ID: NPO1320
Plant Latin Name: Thalictrum Ichangense
Taxonomy Genus: Thalictrum
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 1084677
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

19 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

14 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

6 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC78222

Ingredient ID: NPC50100

Ingredient ID: NPC291545

Ingredient ID: NPC285749

Ingredient ID: NPC272902

Ingredient ID: NPC271027

Ingredient ID: NPC270625

Ingredient ID: NPC255550

Ingredient ID: NPC235251

Ingredient ID: NPC224584

Ingredient ID: NPC216630

Ingredient ID: NPC204820

Ingredient ID: NPC199137

Ingredient ID: NPC155767

Ingredient ID: NPC154298

Ingredient ID: NPC138925

Ingredient ID: NPC136996

Ingredient ID: NPC12231

Ingredient ID: NPC109163

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Fatty acid binding protein family	FABP4	Fatty acid binding protein adipocyte	P15090	CHEMBL2083
Therapeutic Target	Transient receptor potential channel	TRPV1	Vanilloid receptor	Q8NER1	CHEMBL4794

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	48

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT03794388	Evaluation in the Treatment of Neuropathic Pain Post Breast Surgery	breast cancer	Capsaicin (NPC255550)	NP level
NCT02570841	Pain Thresholds Under High-dose Topical Capsaicin	pain	Capsaicin (NPC255550)	NP level
NCT03348735	Localized Neuropathic Pain: Topical Treatment Versus Systemic Treatment	neuropathic pain	Capsaicin (NPC255550)	NP level
NCT03113448	0.075% Capsaicin Lotion for the Treatment of Painful Diabetic Neuropathy	diabetic neuropathy	Capsaicin (NPC255550)	NP level
NCT01699854	Capsaicin Patch 8 % for the Treatment of Persistent Pain After Inguinal Herniotomy	pain	Capsaicin (NPC255550)	NP level
NCT00008476	Capsaicin to Control Pain Following Third Molar Extraction	facial pain	Capsaicin (NPC255550)	NP level
NCT01125215	Capsaicin Nanoparticle in Patient With Painful Diabetic Neuropathy	diabetic neuropathy	Capsaicin (NPC255550)	NP level
NCT00064623	Study of NGX-4010 for the Treatment of Painful HIV-Associated Neuropathy	peripheral nervous system disease;pain	Capsaicin (NPC255550)	NP level
NCT01260454	The Qutenza Patch as Treatment for Disabling Treprostinil (Remodulin) Infusion Site Pain	pulmonary arterial hypertension	Capsaicin (NPC255550)	NP level
NCT03223350	Topical Capsaicin for Cyclical Vomiting	Vomiting	Capsaicin (NPC255550)	NP level
NCT05226299	Cough Desensitization Therapy: Pilot 2	Cough	Capsaicin (NPC255550)	NP level
NCT01478607	A Study to Evaluate the Long-term Safety of Repeated QUTENZA Administration for Treatment of Pain Caused by Nerve Damage in Diabetic Patients	diabetic neuropathy	Capsaicin (NPC255550)	NP level
NCT02769910	Effects of High-concentration Topical Capsaicin on Histaminergic and Non-histaminergic Itch	Pruritus	Capsaicin (NPC255550)	NP level
NCT04545892	Capsaicin for Cerebral Perfusion Augmentation.	stroke	Capsaicin (NPC255550)	NP level
NCT00321672	Study of NGX-4010 for the Treatment of Painful HIV-Associated Neuropathy	peripheral nervous system disease;pain	Capsaicin (NPC255550)	NP level
NCT05029297	Study With Two Capsaicin Topic Treatments in Diabetic Neuropathy.	diabetic neuropathy	Capsaicin (NPC255550)	NP level
NCT03317613	Clinical Trial Assessing the Efficacy of Capsaicin Patch (Qutenza®) in Cancer Patients With Neuropathic Pain	neuropathic pain	Capsaicin (NPC255550)	NP level
NCT00300222	Study of NGX-4010 for the Treatment of Postherpetic Neuralgia	neuralgia;pain	Capsaicin (NPC255550)	NP level
NCT00916942	Study of NGX-4010 With the Use of Open Label Lidocaine (2.5%)/Prilocaine (2.5%) Cream for the Treatment of Postherpetic Neuralgia (PHN)	postherpetic neuralgia	Capsaicin (NPC255550)	NP level
NCT04967664	Comparison of Qutenza (8% Capsaicin) With a Low-dose Capsaicin for Treatment of Nerve Pain After Surgery	neuropathic pain	Capsaicin (NPC255550)	NP level
NCT00130949	ALGRX 4975 in the Treatment of Tennis Elbow	lateral epicondylitis	Capsaicin (NPC255550)	NP level
NCT02710110	Respiratory Strength Training in Persons With Amyotrophic Lateral Sclerosis (ALS)	amyotrophic lateral sclerosis	Capsaicin (NPC255550)	NP level
NCT05093478	The Prevalence of Local Immunoglobulin E (IgE) Elevation and Its Effect on Intranasal Capsaicin Therapy in the Non-allergic Rhinitis Population	non-allergic rhinitis	Capsaicin (NPC255550)	NP level
NCT01595620	Cannabinoid Modulation of Pain	pain	Capsaicin (NPC255550)	NP level
NCT01231750	Efficacy of Topical Capsaicin Cream for Stable Angina	angina pectoris	Capsaicin (NPC255550)	NP level
NCT02695745	Experimental Biomarker Study for Pain Thresholds	pain	Capsaicin (NPC255550)	NP level
NCT01883102	The Effect of Ablation of Epidermal Nerve Fibers Using Capsaicin Cream	pain	Capsaicin (NPC255550)	NP level
NCT00528216	Study of Three Capsaicin Dermal Liquid Formulations on Epidermal Nerve Fiber Immunostaining and Sensory Function	pain	Capsaicin (NPC255550)	NP level
NCT00130962	ALGRX 4975 in the Treatment of Patients With Morton's Neuroma	neuroma	Capsaicin (NPC255550)	NP level
NCT00471055	Efficacy Study on Symptomatic Control of Patient With Knee Osteoarthritis Between 0.0125% of Capsaicin to Placebo	osteoarthritis, knee	Capsaicin (NPC255550)	NP level
NCT02766517	Biomarker Study in Participants With Migraine	migraine disorder	Capsaicin (NPC255550)	NP level
NCT03472677	The Effect of Injection Site Cooling on Pain Experienced After the Administration of CNTX-4975-05 Into the Knee	osteoarthritis, knee	Capsaicin (NPC255550)	NP level
NCT00061152	Pilot Study of High-Concentration Capsaicin Patches in the Treatment of Painful HIV-Associated Neuropathy	HIV infection	Capsaicin (NPC255550)	NP level
NCT02240329	Assessment of Dystussia in Traumatic Brain Injury	brain injury	Capsaicin (NPC255550)	NP level
NCT00993070	Efficacy and Safety Study of Topical Capsaicin in Painful Diabetic Neuropathy	diabetic polyneuropathy	Capsaicin (NPC255550)	NP level
NCT00068081	Controlled Study of NGX-4010 for the Treatment of Postherpetic Neuralgia	neuralgia;pain	Capsaicin (NPC255550)	NP level
NCT00912262	A Study to Investigate the Tolerability and Effects on Epidermal Nerve Fiber Density of Multiple Low-Concentrations of NGX-1998 in Healthy Volunteers	pain	Capsaicin (NPC255550)	NP level
NCT04256733	Cough Desensitization Therapy for Cough Hypersensitivity Syndrome	Cough	Capsaicin (NPC255550)	NP level
NCT03153813	Capsaicin Patches In Knee Osteoarthritis In Obese Patients	pain	Capsaicin (NPC255550)	NP level
NCT04918069	Capsaicin to Prevent Delayed Chemotherapy Induced Nausea and Vomiting (CapCIN)	Chemotherapy-induced nausea and vomiting	Capsaicin (NPC255550)	NP level
NCT00133133	Efficacy and Safety of ALGRX 4975 in the Treatment of Postoperative Pain After Gall Bladder Removal	pain	Capsaicin (NPC255550)	NP level
NCT02700815	Capsaicin + Diclofenac Gel in Acute Back Pain or Neck Pain	pain	Capsaicin (NPC255550)	NP level
NCT00795106	Trial to Evaluate the Efficacy of Topical Capsaicin to Reduce Pain and Improve Health-related Quality of Life in Adults With Chronic Myofascial Neck Pain	myofascial pain syndrome	Capsaicin (NPC255550)	NP level
NCT00146198	Efficacy and Safety of ALGRX 4975 in Treatment of Postoperative Pain After Hernia Repair	pain	Capsaicin (NPC255550)	NP level
NCT00085761	Study of NGX-4010 for Treatment of Painful HIV-Associated Neuropathy	peripheral nervous system disease;pain	Capsaicin (NPC255550)	NP level
NCT00003610	Capsaicin Lozenges in Treating Patients With Mucositis Caused by Radiation Therapy	head and neck malignant neoplasia	Capsaicin (NPC255550)	NP level
NCT03576508	A Study to Compare Levels of Capsaicin After Intra-Articular Injection and Topical Application in Patients With Painful Knee Osteoarthritis	osteoarthritis	Capsaicin (NPC255550)	NP level
NCT00115310	Study of NGX-4010 for the Treatment of Postherpetic Neuralgia	Herpes Zoster;neuralgia;pain	Capsaicin (NPC255550)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Diabetic polyneuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C03.0	NCT00993070,NCT01125215,NCT03113448,NCT01478607,NCT05029297
Neuropathic pain Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43.0	NCT03317613,NCT04967664,NCT03348735
Chronic neuropathic pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30.5Z	NCT00115310,NCT00300222,NCT00068081
Central and peripheral nervous disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A04-8E7Z	NCT00085761,NCT00321672,NCT00064623
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	OR51E2,FABP5,FABP4
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	OR51E2,FABP5,FABP4
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	FABP5,FABP5,OR51E2
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	OR51E2,FABP5,FABP4
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	TRPV1 NCT03576508
Cough Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD12	NCT04256733,NCT05226299
Osteoarthritis of knee Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA01	NCT00471055,NCT03472677
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	FABP5,OR51E2
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	FABP5,OR51E2
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	FABP5,OR51E2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	FABP5,OR51E2
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	TRPV1 NCT00068081,NCT00300222,NCT00085761,NCT01883102,NCT02695745,NCT03153813,NCT00064623,NCT00912262,NCT00528216,NCT00115310,NCT00321672,NCT02700815,NCT00133133,NCT02570841,NCT01595620,NCT01699854,NCT00146198
Visual system disease Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9E1Z	TRPV1
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	TRPV1
Lower limb mononeuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C11	TRPV1
Knee osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA01	TRPV1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	TRPV1
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	TRPV1
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	TRPV1
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	TRPV1
Functional bladder disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GC50	TRPV1
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	TRPV1
Postherpetic polyneuropathy Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E91.5	NCT00916942
Neuroma, NOS Disease Category: X.Extension Codes Disease ICD-11 Code: XH4UE6	NCT00130962
Nausea/vomiting Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD90	NCT04918069
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	NCT00003610
Amyotrophic lateral sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60.0	NCT02710110
Migraine disorder(TM1) Disease Category: 26.Supplementary Chapter Traditional Medicine Conditions - Module I Disease ICD-11 Code: SD10	NCT02766517
Chronic widespread pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30.01	NCT00795106
Vomiting Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD90.1	NCT03223350
Non-allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08.1	NCT05093478
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	NCT01231750
Painful cranial neuropathies or other facial pains Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A85	NCT00008476
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	NCT03794388
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	NCT04545892
Pruritus Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EC90	NCT02769910
Intracranial injury, unspecified Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NA07.Z	NCT02240329
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	NCT01260454
Human immunodeficiency virus disease without mention of associated disease or condition, clinical stage unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62.Z	NCT00061152
Herpes simplex infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00	NCT00115310
Lateral epicondylitis of elbow Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB55.1	NCT00130949
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	FABP5
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	FABP5
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	FABP5
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	FABP4
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	FABP4
Malignant neoplasms of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	FABP4
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	OR51E2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	OR51E2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	OR51E2
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	FABP4
Malignant neoplasms of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	FABP4
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	FABP5
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	FABP5
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	FABP5
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	OR51E2
Malignant neoplasm of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	FABP4

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Thalictrum Ichangense

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

19 All known Ingredients in Total

14 Ingredients with Acceptable Bioavailablity

6 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Diabetic polyneuropathy

Neuropathic pain

Chronic neuropathic pain, unspecified

Central and peripheral nervous disease

Hepatoblastoma

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Hepatocellular carcinoma of liver

Osteoarthritis

Cough

Osteoarthritis of knee

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Adenocarcinoma of prostate

Malignant neoplasms of adrenal gland

Pain, unspecified

Visual system disease

Migraine

Lower limb mononeuropathy

Knee osteoarthritis

Rheumatoid arthritis

Chronic pain

General pain disorder

Atopic eczema

Functional bladder disorder

Asthma

Postherpetic polyneuropathy

Neuroma, NOS

Nausea/vomiting

Head and neck cancer

Amyotrophic lateral sclerosis

Migraine disorder(TM1)

Chronic widespread pain

Vomiting

Non-allergic rhinitis

Angina pectoris

Painful cranial neuropathies or other facial pains

Breast cancer

Ischaemic/haemorrhagic stroke

Pruritus

Intracranial injury, unspecified

Pulmonary hypertension

Human immunodeficiency virus disease without mention of associated disease or condition, clinical stage unspecified

Herpes simplex infection

Lateral epicondylitis of elbow

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Psoriasis

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Non-alcoholic fatty liver disease

Malignant neoplasms of bladder

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of pancreas

Mesothelioma of pleura

Systemic sclerosis

Malignant neoplasms of stomach

Malignant neoplasms of thymus

Glioblastoma of brain

Germ cell tumour of testis

Carpal tunnel syndrome

Malignant neoplasm of pancreas

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities