CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Ferula Persica

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCAATAGCAGAATGACCCGYTAACACGTAAAAACATMGGGCAAGCTTCGGGGGGCCTATGGTCCCCTATTTGCGAACCCAAGGTAGGTGTACCCCTCACGGGTGTCCACCGGCCAACGAAATCAACCGGGCGCTGACTGCGCCAAGGAAATTAATACTGAATTGTTCGTCGCTTCTCGTTCGCGGGCAGCGGCGTCAGTYTGAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTGTTGCCCCYGACCAAACATCCCTCTAGGAGATGTTCCGGTTTGGGGGCGGATACTGGCCTCCCGTGCCYTGTTGTGCGGCTGGCGCAAAAATGAGTCTCTGGCGATGGACGTCGCGACATCGGTGGTTGTAAGAAGACCTTCTTGTCTTGTCGTGTATGCCCGTCACTTTAGTCAGCTCAAGGACCCTTAGGCGCCACAAAATGTGTGATGCGCTTCGA

Click for details-----ITS1

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO13181
Plant Latin Name: Ferula Persica
Taxonomy Genus: Ferula
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 1514040
Plant-of-the-World-Online: 842442-1

Used in Medicines

Country/Region:

India

Traditional Medicine System:

Medicinal Functions:

Antirheumatic

Geographical Distribution

Iran; India; Russia

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

13 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)