• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sinomenium Acutum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCAAAGCAGAATGACCAGTGAATCGGTTGCACTACCACACGACTGGAGTTATGGAGCCTTAAAATCCTACACTTGCATTCGTGTAATTGAAGGGAGGAGAGGCTTCTGTAGCTTCTGTTACAACAACAAAACTCGGCGCATCTTGTGCCAAGGAAATGACAATGGATTAGATGTGCATCCTTACGGCTAGCTAGCTAGCTTGTTGGATGTTATCAGTAATCTCTATTCTTGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAGGCCATCAGGTCGAGGGCACGCCTGCCTGGGCGTCCTGCATTGCGCCACTCCCAACCCAAGGGGAGGGAGTGAAATTGGCCTCCCGTGACTCGTGTGCGGACGGCTGAAAAAGTTGCCCGTTGGTGGCATGCACTACGCGATCAGTGGTGGTTGACAAAACCCATTCACCGAAATAGGATGACTTGATCGAGTAGTTGCCATCGAGGGTAAATTGAACCCTTGTAGCTCMTATACCATGCGACCCCAGGTCAGGCGGGGAC

Click for details-----ITS1

GGATCATTGTCGAAACCTGCAAAGCAGAATGACCAGTGAATCGGTTGCACTACCACACGACTGGAGTTATGGAGCCTTAAAATCCTACACTTGCATTCGTGTAATTGAAGGGAGGAGAGGCTTCTGTAGCTTCTGTTACAACAACAAAACTCGGCGCATCTTGTGCCAAGGAAATGACAATGGATTAGATGTGCATCCTTACGGCTAGCTAGCTAGCTTGTTGGATGTTATCAGTAATCTCTATTCTTGAA

Click for details-----ITS2

ATTGCGCCACTCCCAACCCAAGGGGAGGGAGTGAAATTGGCCTCCCGTGACTCGTGTGCGGACGGCTGAAAAAGTTGCCCGTTGGTGGCATGCACTACGCGATCAGTGGTGGTTGACAAAACCCATTCACCGAAATAGGATGACTTGATCGAGTAGTTGCCATCGAGGGTAAATTGAACCCTTGTAGCTCMTATACCATGCGACCCCAGGTCAGGCGGGGAC
Taxonomic Information

Plant ID: NPO1315
Plant Latin Name: Sinomenium Acutum
Taxonomy Genus: Sinomenium
Taxonomy Family: Menispermaceae

Plant External Links:

NCBI TaxonomyDB: 152363
Plant-of-the-World-Online: 581373-1

Used in Medicines

Country/Region:
Thailand; China

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Anodyne; Carminative

Geographical Distribution

South Africa; Nepal; India; China; Japan; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

120 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


95 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

42 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96603

Ingredient ID: NPC93818

Ingredient ID: NPC92875

Ingredient ID: NPC86570

Ingredient ID: NPC85661

Ingredient ID: NPC84419

Ingredient ID: NPC83546

Ingredient ID: NPC8187

Ingredient ID: NPC81218

Ingredient ID: NPC80999

Ingredient ID: NPC79549

Ingredient ID: NPC78824

Ingredient ID: NPC76217

Ingredient ID: NPC65055

Ingredient ID: NPC6412

Ingredient ID: NPC61510

Ingredient ID: NPC57095

Ingredient ID: NPC55830

Ingredient ID: NPC55161

Ingredient ID: NPC52423

Ingredient ID: NPC51986

Ingredient ID: NPC49480

Ingredient ID: NPC485570

Ingredient ID: NPC48506

Ingredient ID: NPC47936

Ingredient ID: NPC46679

Ingredient ID: NPC44887

Ingredient ID: NPC44217

Ingredient ID: NPC44200

Ingredient ID: NPC39103

Ingredient ID: NPC34111

Ingredient ID: NPC34103

Ingredient ID: NPC328788

Ingredient ID: NPC327583

Ingredient ID: NPC326205

Ingredient ID: NPC326198

Ingredient ID: NPC324735

Ingredient ID: NPC323602

Ingredient ID: NPC323434

Ingredient ID: NPC313032

Ingredient ID: NPC312349

Ingredient ID: NPC305411

Ingredient ID: NPC303008

Ingredient ID: NPC302713

Ingredient ID: NPC298339

Ingredient ID: NPC290005

Ingredient ID: NPC289886

Ingredient ID: NPC288915

Ingredient ID: NPC280372

Ingredient ID: NPC279665

Ingredient ID: NPC2770

Ingredient ID: NPC275625

Ingredient ID: NPC267396

Ingredient ID: NPC266657

Ingredient ID: NPC264958

Ingredient ID: NPC259732

Ingredient ID: NPC256849

Ingredient ID: NPC255607

Ingredient ID: NPC255388

Ingredient ID: NPC254959

Ingredient ID: NPC252540

Ingredient ID: NPC249045

Ingredient ID: NPC248812

Ingredient ID: NPC248029

Ingredient ID: NPC247299

Ingredient ID: NPC244191

Ingredient ID: NPC24228

Ingredient ID: NPC236697

Ingredient ID: NPC235739

Ingredient ID: NPC230301

Ingredient ID: NPC226814

Ingredient ID: NPC217748

Ingredient ID: NPC216832

Ingredient ID: NPC215672

Ingredient ID: NPC215545

Ingredient ID: NPC215119

Ingredient ID: NPC203523

Ingredient ID: NPC198571

Ingredient ID: NPC198560

Ingredient ID: NPC198498

Ingredient ID: NPC197439

Ingredient ID: NPC197262

Ingredient ID: NPC196776

Ingredient ID: NPC195749

Ingredient ID: NPC193486

Ingredient ID: NPC189903

Ingredient ID: NPC189266

Ingredient ID: NPC186718

Ingredient ID: NPC185627

Ingredient ID: NPC185590

Ingredient ID: NPC183684

Ingredient ID: NPC18335

Ingredient ID: NPC178852

Ingredient ID: NPC173669

Ingredient ID: NPC173449

Ingredient ID: NPC16805

Ingredient ID: NPC167546

Ingredient ID: NPC165159

Ingredient ID: NPC161297

Ingredient ID: NPC16107

Ingredient ID: NPC15440

Ingredient ID: NPC153572

Ingredient ID: NPC145879

Ingredient ID: NPC144054

Ingredient ID: NPC142675

Ingredient ID: NPC141765

Ingredient ID: NPC136547

Ingredient ID: NPC129239

Ingredient ID: NPC127588

Ingredient ID: NPC127274

Ingredient ID: NPC125088

Ingredient ID: NPC12053

Ingredient ID: NPC118160

Ingredient ID: NPC115284

Ingredient ID: NPC112206

Ingredient ID: NPC112095

Ingredient ID: NPC110467

Ingredient ID: NPC109813

Ingredient ID: NPC109120

Ingredient ID: NPC107956