• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Balanophora Harlandii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCATGTTGGTTTTAAGGAGTTGACTTTTGAATGTTTTAGTATTTTGATTTTCAGAACTCAATAATTTGTTCTTATATCTTTCGAAGTATCACATTGAATGGTATTTGTATGAATTATATTGGCGTTAATGTTGTATAGGCGTGTATTAAACGTCAAGTTTTTTTCAGTTCTTGATTGGTTGTGTAAGATGATGTGTTATTTATTCAGTCATAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO13123
Plant Latin Name: Balanophora Harlandii
Taxonomy Genus: Balanophora
Taxonomy Family: Balanophoraceae

Plant External Links:

NCBI TaxonomyDB: 447008
Plant-of-the-World-Online: 103255-1

Used in Medicines

Unknown.

Geographical Distribution

India; Taiwan; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

84 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


53 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

25 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99060

Ingredient ID: NPC96128

Ingredient ID: NPC95247

Ingredient ID: NPC86412

Ingredient ID: NPC83925

Ingredient ID: NPC82711

Ingredient ID: NPC81852

Ingredient ID: NPC81388

Ingredient ID: NPC78379

Ingredient ID: NPC74595

Ingredient ID: NPC74434

Ingredient ID: NPC73523

Ingredient ID: NPC71843

Ingredient ID: NPC68798

Ingredient ID: NPC68517

Ingredient ID: NPC66005

Ingredient ID: NPC65152

Ingredient ID: NPC62230

Ingredient ID: NPC61159

Ingredient ID: NPC58636

Ingredient ID: NPC57233

Ingredient ID: NPC47287

Ingredient ID: NPC38408

Ingredient ID: NPC35342

Ingredient ID: NPC32626

Ingredient ID: NPC311700

Ingredient ID: NPC307063

Ingredient ID: NPC302898

Ingredient ID: NPC302172

Ingredient ID: NPC291650

Ingredient ID: NPC287174

Ingredient ID: NPC27765

Ingredient ID: NPC274533

Ingredient ID: NPC268298

Ingredient ID: NPC264317

Ingredient ID: NPC262285

Ingredient ID: NPC261418

Ingredient ID: NPC259690

Ingredient ID: NPC250981

Ingredient ID: NPC250699

Ingredient ID: NPC249105

Ingredient ID: NPC243966

Ingredient ID: NPC243728

Ingredient ID: NPC237801

Ingredient ID: NPC237540

Ingredient ID: NPC230301

Ingredient ID: NPC227344

Ingredient ID: NPC226453

Ingredient ID: NPC221751

Ingredient ID: NPC220007

Ingredient ID: NPC217052

Ingredient ID: NPC215055

Ingredient ID: NPC206314

Ingredient ID: NPC206030

Ingredient ID: NPC20428

Ingredient ID: NPC195305

Ingredient ID: NPC180114

Ingredient ID: NPC178383

Ingredient ID: NPC175955

Ingredient ID: NPC175236

Ingredient ID: NPC173471

Ingredient ID: NPC171125

Ingredient ID: NPC165287

Ingredient ID: NPC162817

Ingredient ID: NPC157193

Ingredient ID: NPC156947

Ingredient ID: NPC153813

Ingredient ID: NPC151981

Ingredient ID: NPC150427

Ingredient ID: NPC144075

Ingredient ID: NPC142415

Ingredient ID: NPC138489

Ingredient ID: NPC137949

Ingredient ID: NPC133017

Ingredient ID: NPC124011

Ingredient ID: NPC113733

Ingredient ID: NPC112236

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC106561

Ingredient ID: NPC105316

Ingredient ID: NPC104619

Ingredient ID: NPC104038

Ingredient ID: NPC103833