• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hymenoxys Microcephala


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAACCCTGCTTGGCAGAACAACCCGTGAACAAGTAATAACAACACGGATTCTCGGGCATCAGGCTTTCGGCTTGACGCTCGTGAAGCCTTGTCGTGGTGTGCTCATGGTCGCTTGTAAGGGCGTCATGGGTGTCATCTCGGCACCTAAACAAACCCCCGGCACGACACGTGCCAAGGAAAACCTAACTTAAGATGGCTCGGTCAACCGCGTCCCGTCTATGGTGTGCGCGTTGTACATGGCTTCTTTATAATCCTAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO13119
Plant Latin Name: Hymenoxys Microcephala
Taxonomy Genus: Hymenoxys
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 128724
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

28 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


21 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

13 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98928

Ingredient ID: NPC96294

Ingredient ID: NPC76336

Ingredient ID: NPC74165

Ingredient ID: NPC68533

Ingredient ID: NPC51700

Ingredient ID: NPC49074

Ingredient ID: NPC4796

Ingredient ID: NPC38419

Ingredient ID: NPC291012

Ingredient ID: NPC272500

Ingredient ID: NPC26020

Ingredient ID: NPC250260

Ingredient ID: NPC243728

Ingredient ID: NPC231548

Ingredient ID: NPC230301

Ingredient ID: NPC229655

Ingredient ID: NPC219913

Ingredient ID: NPC203719

Ingredient ID: NPC201562

Ingredient ID: NPC201275

Ingredient ID: NPC162839

Ingredient ID: NPC153233

Ingredient ID: NPC147642

Ingredient ID: NPC13143

Ingredient ID: NPC112674

Ingredient ID: NPC107482

Ingredient ID: NPC103344