• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rhamnus Davurica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

AACGTTGCCCCCCCAAACCTCGACTTCCAAGAGGACGGGGGGCGGATGCTGGCCTCCCGCGCGCCACGGCTCGCGGTTGGCCTAAATGCGAGTACTCGGCGACGAGCGCCGCGGCAATCGGTGGTTGTCCAACCCTCGGTGCCATGCTGCGCGCGCGATCC
Taxonomic Information

Plant ID: NPO13054
Plant Latin Name: Rhamnus Davurica
Taxonomy Genus: Rhamnus
Taxonomy Family: Rhamnaceae

Plant External Links:

NCBI TaxonomyDB: 105902
Plant-of-the-World-Online: 718301-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

United States; China; Russia; Mongolia; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

16 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


14 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC70622

Ingredient ID: NPC69496

Ingredient ID: NPC39830

Ingredient ID: NPC3224

Ingredient ID: NPC29017

Ingredient ID: NPC282923

Ingredient ID: NPC278175

Ingredient ID: NPC277072

Ingredient ID: NPC267205

Ingredient ID: NPC254848

Ingredient ID: NPC254847

Ingredient ID: NPC158735

Ingredient ID: NPC155853

Ingredient ID: NPC137949

Ingredient ID: NPC116775

Ingredient ID: NPC105591