• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Kielmeyera Albopunctata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAACCCGCCCCCCAGAACGACCCGCGAACCCGTTCATCACACTCCCGTCGCSGGCGGGGGGGGAGGCCGATMGACAAGGCCCTCCCCCCCCGGCGCGAACAACCAACCCCGGCGCGGGACGCGCCAAGGAACAACGAAAATAAAGAAGGGGACGCCCCGTCCGCCCCGGAAACGGCGCGCGCGACGGGGGCGCCTCCCTCTCTTGTTACGAGTCGAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO13045
Plant Latin Name: Kielmeyera Albopunctata
Taxonomy Genus: Kielmeyera
Taxonomy Family: Calophyllaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

17 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


14 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC81738

Ingredient ID: NPC73995

Ingredient ID: NPC483435

Ingredient ID: NPC483434

Ingredient ID: NPC483433

Ingredient ID: NPC483432

Ingredient ID: NPC38639

Ingredient ID: NPC300776

Ingredient ID: NPC282886

Ingredient ID: NPC273367

Ingredient ID: NPC251355

Ingredient ID: NPC230301

Ingredient ID: NPC20791

Ingredient ID: NPC192638

Ingredient ID: NPC190362

Ingredient ID: NPC176814

Ingredient ID: NPC101830