• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ipomoea Cairica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAATGACCAGAGAACACGTTTGTTATTCACTATTCTCGACCGTGACGCGTCCTTCCTCCCGAGGGGGGTGTGTCTCGGGCGATTAACGAACCCCCGGCGCGGAACGCGCCAAGGAATACCTTATTGAGATGGTCGGCCGCCCGTGCCCCGTTACCGCGGATCGCTCGGGAGGCGTTGGCGTCTTACTTAATCAAATACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCAATGCTTGGCCCCTGGTCGAGCGCGGGGAGCGGACGATGGCCTCCCGTGCCCCCTCGGGGCGCGGCTGGCCCAAATGCGAGTCCTTGGCGACGGACGTCACGGCGAGTGGTGGTCGTACCCAGCGTGTGCATATCTTCGCGCCGTGCCCCCGTCGTTCGCGGACGAATGACCCAAACGAGCCCCGTCAGCGTTAGCTCTACGACCGCGACCCCAGGTCAG

Click for details-----ITS1

TCGAAACCTGCACAGCAGAATGACCAGAGAACACGTTTGTTATTCACTATTCTCGACCGTGACGCGTCCTTCCTCCCGAGGGGGGCGTGTCTCGGGCGATTAACGAACCCCCGGCGCGGAACGCGCCAAGGAATACCTTATTGAGATGGCCGGTCGCCCGTGCCCCGTTACCACGGATCGCTCGGGAGGCGTTGGCGTCTTACTTAATCAAATA

Click for details-----ITS2

ATCGCGTCGCCCCCAATGCTTGGCCCCTGGTCGAGCGCGGGGAGCGGACGATGGCCTCCCGTGCCCCCTCGGGGCGCGGCTGGCCCAAATGCGAGTCCTTGGCGACGGACGTCACGGCGAGTGGTGGTCGTACCCAGCGTGTGCATATCTTCGCGCCGTGCCCCCGTCGTTCGCGGACGAATGACCCAAACGAGCCCCGTCAGCGTTAGCTCTACGACCGCGACCCCAGGTCAG
Taxonomic Information

Plant ID: NPO13014
Plant Latin Name: Ipomoea Cairica
Taxonomy Genus: Ipomoea
Taxonomy Family: Convolvulaceae

Plant External Links:

NCBI TaxonomyDB: 129201
Plant-of-the-World-Online: 268564-1

Used in Medicines

Country/Region:
Thailand; Argentina; China; India

Traditional Medicine System:
Indian Folk; TCM

Geographical Distribution

Brazil; Madagascar; Italy; Bangladesh; Liberia; Sudan; Guinea; Nepal; Ethiopia; Rwanda; Tanzania; Somalia; Peru; Laos; Argentina; Bolivia; Cameroon; Cote d'Ivoire; Ecuador; Ghana; Saudi Arabia; Australia; Vanuatu; Cuba; Togo; Zambia; Cape Verde; Papua New Guinea; Malawi; Sri Lanka; Trinidad and Tobago; Zimbabwe; China; Vietnam; Thailand; United States; Sierra Leone; Nigeria; Eritrea; Swaziland; Pakistan; Gambia; Philippines; Indonesia; New Caledonia; Mauritius; Paraguay; Uruguay; Gabon; Guinea-Bissau; Guyana; New Zealand; Yemen; Jamaica; Seychelles; Angola; Myanmar; Equatorial Guinea; Egypt; Mexico; India; South Africa; Uganda; Senegal; Congo; Mozambique; Colombia; Burundi; Kenya; Taiwan; Fiji; Botswana

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

144 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


96 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

77 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC95031

Ingredient ID: NPC91335

Ingredient ID: NPC88566

Ingredient ID: NPC87854

Ingredient ID: NPC84721

Ingredient ID: NPC84030

Ingredient ID: NPC83638

Ingredient ID: NPC81035

Ingredient ID: NPC78500

Ingredient ID: NPC7654

Ingredient ID: NPC76510

Ingredient ID: NPC76315

Ingredient ID: NPC76145

Ingredient ID: NPC71074

Ingredient ID: NPC70432

Ingredient ID: NPC68889

Ingredient ID: NPC68409

Ingredient ID: NPC68098

Ingredient ID: NPC61

Ingredient ID: NPC60389

Ingredient ID: NPC60339

Ingredient ID: NPC56014

Ingredient ID: NPC54925

Ingredient ID: NPC53206

Ingredient ID: NPC53079

Ingredient ID: NPC52021

Ingredient ID: NPC51700

Ingredient ID: NPC50898

Ingredient ID: NPC4982

Ingredient ID: NPC48338

Ingredient ID: NPC47646

Ingredient ID: NPC46274

Ingredient ID: NPC46248

Ingredient ID: NPC45536

Ingredient ID: NPC45270

Ingredient ID: NPC44437

Ingredient ID: NPC43211

Ingredient ID: NPC42572

Ingredient ID: NPC3824

Ingredient ID: NPC36530

Ingredient ID: NPC34679

Ingredient ID: NPC329078

Ingredient ID: NPC32365

Ingredient ID: NPC31751

Ingredient ID: NPC315005

Ingredient ID: NPC313979

Ingredient ID: NPC312454

Ingredient ID: NPC311517

Ingredient ID: NPC311348

Ingredient ID: NPC306541

Ingredient ID: NPC30621

Ingredient ID: NPC304873

Ingredient ID: NPC304309

Ingredient ID: NPC301610

Ingredient ID: NPC300351

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC292559

Ingredient ID: NPC286212

Ingredient ID: NPC283170

Ingredient ID: NPC280945

Ingredient ID: NPC279121

Ingredient ID: NPC278102

Ingredient ID: NPC275407

Ingredient ID: NPC274179

Ingredient ID: NPC270849

Ingredient ID: NPC270180

Ingredient ID: NPC269822

Ingredient ID: NPC260727

Ingredient ID: NPC259733

Ingredient ID: NPC257124

Ingredient ID: NPC252997

Ingredient ID: NPC24761

Ingredient ID: NPC243728

Ingredient ID: NPC241784

Ingredient ID: NPC239117

Ingredient ID: NPC235665

Ingredient ID: NPC235053

Ingredient ID: NPC232083

Ingredient ID: NPC231056

Ingredient ID: NPC230301

Ingredient ID: NPC227632

Ingredient ID: NPC226374

Ingredient ID: NPC226250

Ingredient ID: NPC225644

Ingredient ID: NPC216746

Ingredient ID: NPC214691

Ingredient ID: NPC212451

Ingredient ID: NPC211565

Ingredient ID: NPC210457

Ingredient ID: NPC210003

Ingredient ID: NPC209431

Ingredient ID: NPC20505

Ingredient ID: NPC204243

Ingredient ID: NPC204120

Ingredient ID: NPC202904

Ingredient ID: NPC201384

Ingredient ID: NPC200209

Ingredient ID: NPC197545

Ingredient ID: NPC195667

Ingredient ID: NPC190810

Ingredient ID: NPC189248

Ingredient ID: NPC189142

Ingredient ID: NPC184105

Ingredient ID: NPC183950

Ingredient ID: NPC18205

Ingredient ID: NPC18074

Ingredient ID: NPC178890

Ingredient ID: NPC176814

Ingredient ID: NPC176309

Ingredient ID: NPC173696

Ingredient ID: NPC165991

Ingredient ID: NPC162742

Ingredient ID: NPC158654

Ingredient ID: NPC158059

Ingredient ID: NPC157193

Ingredient ID: NPC155500

Ingredient ID: NPC152384

Ingredient ID: NPC151620

Ingredient ID: NPC150950

Ingredient ID: NPC150610

Ingredient ID: NPC14568

Ingredient ID: NPC142415

Ingredient ID: NPC141777

Ingredient ID: NPC140688

Ingredient ID: NPC137949

Ingredient ID: NPC130209

Ingredient ID: NPC128988

Ingredient ID: NPC128543

Ingredient ID: NPC125041

Ingredient ID: NPC124774

Ingredient ID: NPC12319

Ingredient ID: NPC120217

Ingredient ID: NPC119949

Ingredient ID: NPC119620

Ingredient ID: NPC119092

Ingredient ID: NPC118726

Ingredient ID: NPC117707

Ingredient ID: NPC116140

Ingredient ID: NPC113733

Ingredient ID: NPC112701

Ingredient ID: NPC11089

Ingredient ID: NPC109813

Ingredient ID: NPC102738

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 2 CYP2C19 Cytochrome P450 2C19 P33261 CHEMBL3622
Therapeutic Target Enzyme CES1 Acyl coenzyme A:cholesterol acyltransferase P23141 CHEMBL2265
Therapeutic Target Enzyme RECQL ATP-dependent DNA helicase Q1 P46063 CHEMBL1293236
Therapeutic Target Enzyme APEX1 DNA-(apurinic or apyrimidinic site) lyase P27695 CHEMBL5619
Therapeutic Target Enzyme POLB DNA polymerase beta P06746 CHEMBL2392
Therapeutic Target Enzyme NOX4 NADPH oxidase 4 Q9NPH5 CHEMBL1250375
Therapeutic Target Hydrolase ACHE Acetylcholinesterase P22303 CHEMBL220
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA1 Carbonic anhydrase I P00915 CHEMBL261
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Lyase CA2 Carbonic anhydrase II P00918 CHEMBL205
Therapeutic Target Lyase CA14 Carbonic anhydrase XIV Q9ULX7 CHEMBL3510
Therapeutic Target Lyase CA9 Carbonic anhydrase IX Q16790 CHEMBL3594
Therapeutic Target Lyase CA4 Carbonic anhydrase IV P22748 CHEMBL3729
Therapeutic Target Metallo protease MMP9 Matrix metalloproteinase 9 P14780 CHEMBL321
Therapeutic Target Metallo protease MMP12 Matrix metalloproteinase 12 P39900 CHEMBL4393
Therapeutic Target Metallo protease MMP2 Matrix metalloproteinase-2 P08253 CHEMBL333
Therapeutic Target Metallo protease MMP1 Matrix metalloproteinase-1 P03956 CHEMBL332
Therapeutic Target Nuclear hormone receptor subfamily 1 RORC Nuclear receptor ROR-gamma P51449 CHEMBL1741186
Therapeutic Target Nuclear hormone receptor subfamily 1 NR1H4 Bile acid receptor FXR Q96RI1 CHEMBL2047
Therapeutic Target Nuclear hormone receptor subfamily 3 ESR2 Estrogen receptor beta Q92731 CHEMBL242
Therapeutic Target Oxidoreductase HSD17B1 Estradiol 17-beta-dehydrogenase 1 P14061 CHEMBL3181
Therapeutic Target Oxidoreductase ALOX15 Arachidonate 15-lipoxygenase P16050 CHEMBL2903
Therapeutic Target Oxidoreductase HSD11B1 11-beta-hydroxysteroid dehydrogenase 1 P28845 CHEMBL4235
Therapeutic Target Phosphodiesterase TDP1 Tyrosyl-DNA phosphodiesterase 1 Q9NUW8 CHEMBL1075138
Therapeutic Target Protein Kinase MKNK2 MAP kinase signal-integrating kinase 2 Q9HBH9 CHEMBL4204
Therapeutic Target Protein Kinase FLT3 Tyrosine-protein kinase receptor FLT3 P36888 CHEMBL1974
Therapeutic Target Protein Kinase MAP2K1 Dual specificity mitogen-activated protein kinase kinase 1 Q02750 CHEMBL3587
Therapeutic Target Protein Kinase CSNK2A1 Casein kinase II alpha P68400 CHEMBL3629
Therapeutic Target Protein Kinase MKNK1 MAP kinase-interacting serine/threonine-protein kinase MNK1 Q9BUB5 CHEMBL4718
Therapeutic Target Protein Phosphatase CDC25B Dual specificity phosphatase Cdc25B P30305 CHEMBL4804
Therapeutic Target Secreted protein THPO Thrombopoietin P40225 CHEMBL1293256
Therapeutic Target Secreted protein TTR Transthyretin P02766 CHEMBL3194
Therapeutic Target Serine protease F2 Thrombin P00734 CHEMBL204
Therapeutic Target Serine protease DPP4 Dipeptidyl peptidase IV P27487 CHEMBL284
Therapeutic Target Small molecule receptor (family A GPCR) CNR2 Cannabinoid CB2 receptor P34972 CHEMBL253
Therapeutic Target Surface antigen F3 Coagulation factor III P13726 CHEMBL4081
Therapeutic Target Transcription factor NFKB1 Nuclear factor NF-kappa-B p105 subunit P19838 CHEMBL3251
Therapeutic Target Transcription factor HIF1A Hypoxia-inducible factor 1 alpha Q16665 CHEMBL4261
Therapeutic Target Transcription factor RELA Nuclear factor NF-kappa-B p65 subunit Q04206 CHEMBL5533
Therapeutic Target Unclassified protein SNCA Alpha-synuclein P37840 CHEMBL6152
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level21
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT02337933 Effect of Ursolic Acid Administration on Insulin Sensitivity and Metabolic Syndrome metabolic syndrome Ursolic Acid (NPC51700) NP level
NCT04403568 Testing the Synergism of Phytonutrients, Curcumin and Ursolic Acid, to Target Molecular Pathways in the Prostate prostate cancer Ursolic Acid (NPC51700) NP level
NCT00143702 D4T or Abacavir Plus Vitamin Enhancement in HIV-Infected Patients (DAVE) lactic acidosis Thiamine (NPC150950) NP level
NCT04853082 Limonene on Regulating Metabolism-related Fatty Liver Disease (MAFLD) and Analysis of TCM Constitution Hepatic steatosis Limonene (NPC76145) NP level
NCT03872011 Vitamin C, Thiamine and Hydrocortisone for the Treatment of Septic Shock septic shock Thiamine (NPC150950) NP level
NCT00861523 Does Thiamine Help Vomiting and Nausea in Pregnancy? hyperemesis gravidarum Thiamine (NPC150950) NP level
NCT04478734 Trial of the Combined Use of Thiamine and Biotin in Patients With Huntington's Disease Huntington disease Thiamine (NPC150950) NP level
NCT04648917 GASC1 Inhibitor Caffeic Acid for Squamous Esophageal Cell Cancer (ESCC) esophageal cancer Caffeic Acid (NPC294902) NP level
NCT01985685 The Effect of Thiamine vs. Placebo on VO2 in Critical Illness respiratory failure Thiamine (NPC150950) NP level
NCT04392622 d-Limonene +Radiation +Platinum Based Chemo for Xerostomia Prevention in Locally Advanced Head and Neck Squamous Cell Carcinoma xerostomia Limonene (NPC76145) NP level
NCT01381354 Nutrition, Neuromuscular Electrical Stimulation (NMES) and Secondary Progressive Multiple Sclerosis (SPMS) multiple sclerosis Thiamine (NPC150950) NP level
NCT01115504 Thiamine Supplementation in Heart Failure Patients Receiving Full Medical Therapy heart failure Thiamine (NPC150950) NP level
NCT01070810 Thiamine as a Metabolic Resuscitator in Septic Shock septic shock Thiamine (NPC150950) NP level
NCT03450707 Thiamine as a Metabolic Resuscitator After Cardiac Arrest cardiac arrest Thiamine (NPC150950) NP level
NCT02351622 Caffeic Acid Tablets as a Second-line Therapy for ITP autoimmune thrombocytopenic purpura Caffeic Acid (NPC294902) NP level
NCT01005303 Micronutrient Supplementation in Patients With Heart Failure heart failure Thiamine (NPC150950) NP level
NCT03509662 Vitamin C in Post-cardiac Arrest cardiac arrest Thiamine (NPC150950) NP level
NCT04921189 Steroid, Thiamine and Ascorbic Acid for Comatose Out-of-hospital Cardiac Arrest Survivors cardiac arrest Thiamine (NPC150950) NP level
NCT03216876 A Study Of Ursolic Acid For Primary Sclerosing Cholangitis sclerosing cholangitis Ursolic Acid (NPC51700) NP level
NCT03509350 Vitamin C, Thiamine, and Steroids in Sepsis Sepsis Thiamine (NPC150950) NP level
NCT03333278 The Vitamin C, Hydrocortisone and Thiamine in Patients With Septic Shock Trial Sepsis;septic shock Thiamine (NPC150950) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CSNK2A3,CA12,CYP1B1,AKR1B10,CA9,PTPRC,DPP4,CA2,CYP19A1
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 F2,NOX4,MMP12,CYP19A1,ALOX15,MMP9,CDC25B,MMP1
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 CA12,HSD17B1,AKR1B10,CA9,MMP12,MMP9,XDH,MMP1
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 HSD17B1,TTR,CA9,CYP1A2,CA2,MMP9,MMP1,AKR1B1
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA7,CYP1B1,NOX4,CA12,MMP12,DPP4,XDH,MMP1
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 MMP9,CDC25B,RORC,MMP1,MMP2,FLT3,MMP12
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 NFKB1,RELA,DPP4,RORC,FLT3
 AKR1B10,MMP12
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 MMP1,RELA,MMP9,NFKB1,CA1,CA2,AKR1B1
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 MMP9,CNR2,RORC
 MMP9,HSD11B1,MMP12,MMP1
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 NOX4,CA9,MMP12,CYP1A1,F2,CDC25B,MMP1
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 ACHE,NOX4,MMP12,ALOX15,MMP9,CDC25B,MMP1
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CNR2,CA12,CA9,MMP12,THPO,MMP9,MMP1
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 PTPN1,RELA,DPP4,NFKB1,HSD11B1,F2
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 HSD11B1,ACHE,CA2,CA1,AKR1B1,CA4
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 F2,NOX4,CA9,MMP12,MMP9,MMP1
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 CA4,ACHE,SNCA,HSD17B1,DPP4,CA2
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 CYP1B1,NOX4,THPO,DPP4,HSD11B1,MMP2
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 GSK3B,NFKB1,PTPRC,RELA,FLT3
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 MKNK1,HIF1A,MKNK2,CA9,PTPRC
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 HSD11B1,FLT3,SNCA,ACHE,ESR2
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 MMP12,MMP2,CA9,PKM,MMP9
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 F2,RORC,RELA,NFKB1
 NCT01381354
Inflammatory bowel diseases, unspecified
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD7Z
 NOX4,MMP12,MMP9,HSD11B1,MMP1
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 F2,CA4,F3,RORC,CA14
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CA9,MMP12,CYP1A1,MMP9,MMP1
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 MMP2,HIF1A,CYP19A1,XDH,F3
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CYP1A1,CA2,TTR,CA12,CYP1A2
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA12,CA2,CA4,CA14
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 AKR1B1,HSD11B1,PTPN1,DPP4
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 MMP9,MMP1,HIF1A,MMP2
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 XDH,CA2
 NCT01005303,NCT01115504
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 AKR1B1,CNR2,ACHE,PKM
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 DPP4,PTPN1,HSD11B1
 NCT02337933
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA1,CA12,CA2,CA4
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 ACHE,NFKB1,DPP4,CYP19A1
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 NOX4,TTR,PTPRC,NR1I2
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 ACHE,CYP1A1,MMP9,F3
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 MMP9,AKR1B10,NOX4,MMP12
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 CSNK2A1,MKNK1,MKNK2
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 ACHE,SNCA,GSK3B
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 NFKB1,CNR2,RELA
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 F3,MMP2,MMP1
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 NFKB1,RELA,DPP4
Ischaemic/haemorrhagic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B20
 THPO,F2,MMP9
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 F2,DPP4,THPO
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 PTPRC,DPP4,FLT3
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 F2,CA4,MMP12
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 MKNK2,MKNK1,FLT3
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 NFKB1,RELA,ESR2
Sepsis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G40-1G41
 ESR2
 NCT03333278,NCT03509350
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 HSD11B1,CES1,ESR2
Lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40
 NFKB1,RELA,HSD11B1
Septic shock
Disease Category: X.Extension Codes
Disease ICD-11 Code: XS26
 NCT01070810,NCT03872011,NCT03333278
Cardiac arrest
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MC82
 NCT04921189,NCT03509662,NCT03450707
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12,MMP9,MMP2
Pneumonia due to Pseudomonasaeruginosa
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.05
 MMP9,DPP4,MMP12
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 NOX4,TTR,ALOX15
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 ACHE,CA7,CES1,DPP4,POLB,CA2,XDH,RECQL,CYP1B1,AKR1B10,HIF1A,F2,MMP1,CNR2,SNCA,TTR,CA9,PTPRC,PTPN1,ALOX15,HSD11B1,CA14,NR1I2,CDC25B,MMP2,CYP2C19
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 CSNK2A1,PKM,CA12,RORC,F3,FLT3,MKNK2,RELA,GSK3B,NFKB1,CA2,CA14,HIF1A,MKNK1,APEX1,POLB,XDH,CA4,CA9,CA1,MMP9
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CSNK2A1,PKM,MMP12,CA2,XDH,AKR1B10,PSMB5,MMP9,MMP1,APEX1,NOX4,CA9,RORC,PTPRC,ALOX15,CSNK2A3,CA12,CYP1A2,TDP1,NR1I2
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 CSNK2A1,ACHE,RECQL,PSMB5,CSNK2A2,MMP1,APEX1,CNR2,NOX4,CA9,PTPN1,HSD11B1,F3,CA12,ESR2,THPO,TDP1,NR1I2,MMP2,AKR1B1
BCR-ABL1-negative chronic myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A41
 PTPRC,FLT3
Muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70
 NFKB1,RELA
Acute/subacute hepatic failure
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB91
 RELA,NFKB1
Fungal infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F29-1F2F
 RELA,NFKB1
Insomnia
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A00-7A0Z
 CNR2,CA2
Diffuse large B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 FLT3,PTPRC
Myasthenia gravis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C6Y
 HSD11B1,ACHE
Myeloproliferative neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A20
 GSK3B,FLT3
Inborn lipid metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C52
 CNR2,HSD11B1
Duodenal ulcer
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA63
 CA1,CA2
Bleeding disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA20-GA21
 F3,F2
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 CES1,DPP4
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 CYP19A1,AKR1B1
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 HSD11B1,PTPN1
Influenza
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E30-1E32
 HSD11B1,XDH
Cushing syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A70
 CYP19A1,ESR2
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 AKR1B1,F2
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 ESR2
 NCT04403568
Skin and skin-structure infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F28-1G0Z
 RELA,NFKB1
Choreiform disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A01
 NFKB1,RELA
Irritable bowel syndrome
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD91
 NFKB1,RELA
Transplanted organ/tissue
Disease Category: 24.Factors influencing health status or contact with health services
Disease ICD-11 Code: QB63
 PTPRC,FLT3
Pre-eclampsia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA24
 CA1,CA4
Systemic sclerosis
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A42
 NOX4,MMP1
Human immunodeficiency virus disease without mention of tuberculosis or malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C62
 CNR2,FLT3
Lyme borreliosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C1G
 MMP9,CA1
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 PKM,CA7,MMP12,DPP4,POLB,CA2,XDH,AKR1B10,PSMB5,MMP9,MMP1,CA9,RORC,CYP19A1,ALOX15,TDP1,CA14,NR1I2,AKR1B1
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CA7,MMP12,DPP4,XDH,RECQL,AKR1B10,CSNK2A2,MMP9,MMP1,APEX1,CNR2,SNCA,CA9,FLT3,PTPRC,ALOX15,CA12,TDP1,CDC25B
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CA4,PKM,CA12,AKR1B10,NOX4,CA9,MMP12,CYP19A1,MMP9,MMP1,PKM,CA12,AKR1B10,CA9,MMP12,CYP19A1,MMP9,CDC25B,MMP1
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 ACHE,DPP4,XDH,CA4,HIF1A,F2,MMP1,CNR2,SNCA,NOX4,TTR,PTPRC,CA12,CA14,CDC25B,MMP2,AKR1B1
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 ACHE,NFKB1,MMP12,DPP4,CYP1B1,AKR1B10,PSMB5,MMP9,APEX1,CNR2,CA9,FLT3,PTPRC,ALOX15,AKR1B1
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 CSNK2A1,PKM,MMP12,CA4,HIF1A,MMP9,MMP1,NOX4,CA9,F3,CSNK2A3,ESR2,AKR1B1,MMP2
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 ACHE,AKR1B10,CA9,CYP19A1,MMP9,XDH,F2,CA9,MMP12,PTPRC,CA1,MMP9,MMP1
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 ACHE,CA7,AKR1B10,F2,TTR,CA9,MMP12,CA12,THPO,NR1I2,MMP9,XDH,MMP1
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 ACHE,MMP12,CA2,XDH,CA4,MMP9,MMP1,SNCA,NOX4,TTR,RORC,CA14
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 PKM,MMP12,CA4,AKR1B10,MMP9,MMP1,NOX4,CYP19A1,CA12,CA1,MMP2,AKR1B1
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 CNR2,AKR1B10,NOX4,MMP12,FLT3,PTPN1,DPP4,MMP9,MMP2,CDC25B,MMP1,AKR1B1
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CNR2,ACHE,CYP2C19,ESR2,THPO,CA1,CA14,CYP1A1,CA2,ALOX15,MMP9,KDM4E
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA14,CA1,PTPN1,CA12,ESR2,MKNK1,CYP19A1,CA4,MKNK2,CA9,CA2
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 PKM,F2,AKR1B10,CA9,MMP12,CYP1A1,CA2,ALOX15,MMP9,XDH,MMP1
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 CA4,CA7,SNCA,NOX4,CA9,MMP12,CA12,DPP4,CYP19A1,MMP9,MMP1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 F2,CA7,HSD17B1,AKR1B10,CA9,MMP12,CA12,MMP9,XDH,MMP1
Prostate hyperplasia
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA90
 ESR2
Cardiomyopathy
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC43
 TTR
Vasomotor/allergic rhinitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA08
 ESR2
Inborn metabolism deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5C59
 CA14
Oesophagitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA24
 CYP19A1
Peroxisomal disease
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C57
 CES1
Nasopharyngeal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6B
 CDC25B
Mature B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A85
 FLT3
Amyloidosis
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5D00
 TTR
NA
Disease Category: NA
Disease ICD-11 Code: NA
 NOX4
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 HIF1A
Phakomatoses/hamartoneoplastic syndrome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD2D
 FLT3
Inflammatory arthropathy
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA2Z
 FLT3
Osteosarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B51
 GSK3B
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 F2
Nutritional deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B50-5B71
 F2
Attention deficit hyperactivity disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A05
 CNR2
Menopausal disorder
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA30
 ESR2
Human immunodeficiency virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C60-1C62
 FLT3
Coronavirus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D92
 CSNK2A1
Ulcerative colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD71
 MMP9
Hepatitis virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E50-1E51
 ESR2
Autonomic nervous system disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8D87
 SNCA
Ophthalmic devices/implants/grafts injury
Disease Category: 23.External causes of morbidity or mortality
Disease ICD-11 Code: PK97
 PTPN1
Mastocytosis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A21
 FLT3
Hepatic fibrosis/cirrhosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB93
 MMP2
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 F2
Synthesis disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C52-5C59
 CES1
Multiple myeloma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A83
 FLT3
Transplant rejection
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE84
 PTPRC
Myotonic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71
 GSK3B
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 ACHE
Inborn purine/pyrimidine/nucleotide metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C55
 XDH
Encephalopathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E47
 XDH
Autoimmune disease
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40-4A45
 RORC
Unspecified viral infection of unspecified site
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D9Z
 FLT3
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 ACHE
Autism spectrum disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02
 DPP4
Acute respiratory distress syndrome
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB00
 F3
General pain disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E43
 CNR2
Fragile X chromosome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD55
 GSK3B
Idiopathic interstitial pneumonitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03
 FLT3
Gout
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA25
 XDH
Cataract
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B10
 AKR1B1
Unspecific substance harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE6Z
 ACHE
Pediculosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G00
 ACHE
Postoperative inflammation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-CA43
 PTPN1
Essential hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00
 CA2
Low bone mass disorder
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83
 CA2
Coronary thrombosis
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA43
 F2
Mineral deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B5K
 XDH
Endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10
 CYP19A1
Peritoneal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C51
 FLT3
Chronic myelomonocytic leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A40
 FLT3
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 ACHE
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 MMP9
Chronic pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG30
 FLT3
Parasitic worm infestation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F90
 ACHE
Chronic kidney disease
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB61
 XDH
Ocular cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D00-2D07
 APEX1
Cerebral ischaemic stroke
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B11
 F2
Bone/articular cartilage neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F7B
 FLT3
Coagulation defect
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B10
 F2
Ovarian cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73
 FLT3
Acne vulgaris
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED80
 MMP2
Oesophageal/gastroduodenal disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD90
 ACHE
Adrenomedullary hyperfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A75
 HIF1A
Angina pectoris
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA40
 F2
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 AKR1B1
Retinopathy
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B71
 APEX1
Mild hyperemesis gravidarum
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA60.0
 NCT00861523
Huntington disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A01.10
 NCT04478734
Primary sclerosing cholangitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB96.2
 NCT03216876
Other specified non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92.Y
 NCT04853082
Esophageal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 NCT04648917
Immune thrombocytopenic purpura
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64.10
 NCT02351622
Diabetic lactic acidosis
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A22.1
 NCT00143702
Respiratory failure
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB41
 NCT01985685
Xerostomia
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA02.1
 NCT04392622
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1
Zika virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D48
 ACHE
Dengue fever, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D2Z
 NR1I2
Idiopathic pulmonary fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03.4
 MMP12
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
Non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92
 MMP9
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1
Keratoconus
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A78.50
 CA4
Malignant neoplasms of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 CA1
Polycystic ovary syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80.1
 MMP12
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1
Malaria, unspecified
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F4Z
 MMP9
Ebola virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D60.01
 ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group