• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rumex Crispus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCTCAAAGCAGACTGACCCGCGAACCCGTTCCTAACACAAAGGCGCCCCCGGGCGCCGCCAACCCAACCCCGGCGCGGATTGCGCCAAGGACCACGAACAAAATCGCCCCCCGAGCGGCCCGGTCCTCCGGAGCCCGCGCGGCGGCGGCGTGTCGTTTCTACTTAACTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGCCGAGGGCACGTCTGTCTGGGCGTCACGCACCGCGTCGCCCCCCACCCCCCCCCTCCGGGGGGGATCGGGGGCGGAGACTGGCCCCCCGTGCGCCCCGGCGCGCGGCCGGCCTAAACGCAGACCCCGCGGCCGCGAGAACGGCGCGACGATTGGTGGCGTACTTCATGGCATCGCGTCGCGCCCTCTGCGGCCCCCCGGGAGATCATCGGCCCACAAAGCGGACCCCGGTCCACCGTTGCGACCCCAGA

Click for details-----ITS1

GGAGGATTGTCGAAACCTGCTCAGAGCAGACTGACCCGCGAACCCGTTCCTAACACAAACGGCGCCCCCGGGCGCCGCCAACCCACCCCCGGCGCGGATTGCGCCAAGGACCACGAACAAAATCGCCCCCCGGGCGGCCCGGTCCTCCGGAGCCCGCGCGGCGCGGCGTGTCGTTTCTACCTAACAAAAA

Click for details-----ITS2

ACCGCGTCGCCCCCCACCCCCCCCCCCTCCGGGGGGGGGGGATCGGGGGCGGAGACTGGCCCCCCGTGCGCCCCGGCGCGCGGCCGGCCTAAACCCAGACCCCGCGGCCGCGAGAACGGCGCGACGATTGGTGGCGTACTTCATGGCATCGCGTCGCGCCCTCTGCGGCCCCCCGGGAGATCATCGGCCCACAAAGCGGACCCCGGTCCACCGTT
Taxonomic Information

Plant ID: NPO12955
Plant Latin Name: Rumex Crispus
Taxonomy Genus: Rumex
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 174649
Plant-of-the-World-Online: 224413-2

Used in Medicines

Country/Region:
Turkey; Italy; Portugal; South Africa; Mexico; India; South Korea; Russia

Traditional Medicine System:


Medicinal Functions:

Alterative; Antiscorbutic; Astringent; Cancer; Cholagogue; Depurative; Homeopathy; Laxative; Poultice; Salve; Tonic

Geographical Distribution

Brazil; Turkey; Italy; Peru; Sudan; Costa Rica; France; Bahamas; Ethiopia; Norway; Ireland; Bolivia; Cameroon; Ecuador; Belarus; Algeria; Cuba; Iceland; Venezuela; Cape Verde; Russia; United States; Zimbabwe; Germany; Chile; Belgium; Dominican Republic; Spain; Ukraine; Eritrea; Netherlands; Libya; Denmark; Poland; Finland; New Caledonia; Mauritius; Morocco; Sweden; Namibia; Kenya; Switzerland; Honduras; Haiti; Bulgaria; Jamaica; Romania; Albania; Angola; Portugal; Mexico; Egypt; Fiji; South Africa; India; United Kingdom; Lesotho; Austria; Mozambique; Tunisia; Colombia; Greece; Hungary; South Korea; Cyprus; Zambia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

6 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC92229

Ingredient ID: NPC80128

Ingredient ID: NPC67037

Ingredient ID: NPC3224

Ingredient ID: NPC278329

Ingredient ID: NPC267205

Ingredient ID: NPC254848

Ingredient ID: NPC227668

Ingredient ID: NPC176893

Ingredient ID: NPC13758

Ingredient ID: NPC103540