• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sideritis Tragoriganum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TAGGTGAACTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGACCGCGAACACGTTCACAAACMAACCCGGCGCCGCGTGTCGGGGGAGACCCCGGGACGCGGCCCGATCCCGCCGGCGCTCGCGCCGCGCGGGCTAACGAACTCGGGGGCGGAATGCGCCAAGGAAAACGAAATGGAGCGCCCCCCTCCCCCGAGCGCCCCGTYCGCGGGGACACGGGGGGGAAAGGGACGCCTATCGAATGTCTAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO12944
Plant Latin Name: Sideritis Tragoriganum
Taxonomy Genus: Sideritis
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 155267
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

179 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


53 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

60 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC96558

Ingredient ID: NPC94509

Ingredient ID: NPC93220

Ingredient ID: NPC92169

Ingredient ID: NPC91693

Ingredient ID: NPC9000

Ingredient ID: NPC89929

Ingredient ID: NPC88101

Ingredient ID: NPC8694

Ingredient ID: NPC85813

Ingredient ID: NPC82884

Ingredient ID: NPC80507

Ingredient ID: NPC78992

Ingredient ID: NPC75789

Ingredient ID: NPC73479

Ingredient ID: NPC71171

Ingredient ID: NPC68184

Ingredient ID: NPC67251

Ingredient ID: NPC65870

Ingredient ID: NPC61893

Ingredient ID: NPC61771

Ingredient ID: NPC61694

Ingredient ID: NPC596

Ingredient ID: NPC54950

Ingredient ID: NPC54105

Ingredient ID: NPC51888

Ingredient ID: NPC48236

Ingredient ID: NPC47815

Ingredient ID: NPC45659

Ingredient ID: NPC45218

Ingredient ID: NPC430

Ingredient ID: NPC41527

Ingredient ID: NPC37685

Ingredient ID: NPC35777

Ingredient ID: NPC34710

Ingredient ID: NPC32534

Ingredient ID: NPC32298

Ingredient ID: NPC312833

Ingredient ID: NPC309096

Ingredient ID: NPC307050

Ingredient ID: NPC30678

Ingredient ID: NPC305987

Ingredient ID: NPC305315

Ingredient ID: NPC302406

Ingredient ID: NPC301920

Ingredient ID: NPC299849

Ingredient ID: NPC29620

Ingredient ID: NPC294919

Ingredient ID: NPC293487

Ingredient ID: NPC288855

Ingredient ID: NPC287343

Ingredient ID: NPC283170

Ingredient ID: NPC281693

Ingredient ID: NPC280907

Ingredient ID: NPC280052

Ingredient ID: NPC279121

Ingredient ID: NPC278866

Ingredient ID: NPC277597

Ingredient ID: NPC276886

Ingredient ID: NPC275681

Ingredient ID: NPC265557

Ingredient ID: NPC261831

Ingredient ID: NPC258973

Ingredient ID: NPC255352

Ingredient ID: NPC254892

Ingredient ID: NPC25101

Ingredient ID: NPC247792

Ingredient ID: NPC24770

Ingredient ID: NPC246664

Ingredient ID: NPC24651

Ingredient ID: NPC244706

Ingredient ID: NPC243981

Ingredient ID: NPC242332

Ingredient ID: NPC241693

Ingredient ID: NPC241365

Ingredient ID: NPC241192

Ingredient ID: NPC2405

Ingredient ID: NPC234029

Ingredient ID: NPC229469

Ingredient ID: NPC228346

Ingredient ID: NPC227438

Ingredient ID: NPC225630

Ingredient ID: NPC225297

Ingredient ID: NPC22377

Ingredient ID: NPC223463

Ingredient ID: NPC220137

Ingredient ID: NPC219913

Ingredient ID: NPC219751

Ingredient ID: NPC219063

Ingredient ID: NPC217011

Ingredient ID: NPC216060

Ingredient ID: NPC2147

Ingredient ID: NPC214610

Ingredient ID: NPC213862

Ingredient ID: NPC213084

Ingredient ID: NPC212213

Ingredient ID: NPC212150

Ingredient ID: NPC210727

Ingredient ID: NPC209970

Ingredient ID: NPC209936

Ingredient ID: NPC20665

Ingredient ID: NPC205955

Ingredient ID: NPC204731

Ingredient ID: NPC204510

Ingredient ID: NPC203719

Ingredient ID: NPC202945

Ingredient ID: NPC201562

Ingredient ID: NPC200836

Ingredient ID: NPC199414

Ingredient ID: NPC197944

Ingredient ID: NPC194071

Ingredient ID: NPC194040

Ingredient ID: NPC194017

Ingredient ID: NPC193087

Ingredient ID: NPC190185

Ingredient ID: NPC190094

Ingredient ID: NPC190065

Ingredient ID: NPC189142

Ingredient ID: NPC187039

Ingredient ID: NPC184224

Ingredient ID: NPC182191

Ingredient ID: NPC182181

Ingredient ID: NPC181683

Ingredient ID: NPC179393

Ingredient ID: NPC176513

Ingredient ID: NPC174672

Ingredient ID: NPC173686

Ingredient ID: NPC173386

Ingredient ID: NPC171955

Ingredient ID: NPC171432

Ingredient ID: NPC171316

Ingredient ID: NPC170997

Ingredient ID: NPC170129

Ingredient ID: NPC169149

Ingredient ID: NPC168475

Ingredient ID: NPC167767

Ingredient ID: NPC165964

Ingredient ID: NPC165317

Ingredient ID: NPC165050

Ingredient ID: NPC164575

Ingredient ID: NPC163908

Ingredient ID: NPC16378

Ingredient ID: NPC161557

Ingredient ID: NPC16081

Ingredient ID: NPC160116

Ingredient ID: NPC156971

Ingredient ID: NPC154165

Ingredient ID: NPC153658

Ingredient ID: NPC153072

Ingredient ID: NPC152301

Ingredient ID: NPC15167

Ingredient ID: NPC149644

Ingredient ID: NPC146432

Ingredient ID: NPC143268

Ingredient ID: NPC141700

Ingredient ID: NPC141215

Ingredient ID: NPC140604

Ingredient ID: NPC140045

Ingredient ID: NPC137806

Ingredient ID: NPC131048

Ingredient ID: NPC130413

Ingredient ID: NPC128442

Ingredient ID: NPC12649

Ingredient ID: NPC126409

Ingredient ID: NPC122611

Ingredient ID: NPC122033

Ingredient ID: NPC120872

Ingredient ID: NPC120736

Ingredient ID: NPC120426

Ingredient ID: NPC117322

Ingredient ID: NPC115334

Ingredient ID: NPC114973

Ingredient ID: NPC114019

Ingredient ID: NPC113727

Ingredient ID: NPC105734

Ingredient ID: NPC105534

Ingredient ID: NPC103349

Ingredient ID: NPC102527

Ingredient ID: NPC102465

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Therapeutic Target Enzyme NOX4 NADPH oxidase 4 Q9NPH5 CHEMBL1250375
Therapeutic Target Enzyme AKR1C3 Aldo-keto-reductase family 1 member C3 P42330 CHEMBL4681
Therapeutic Target Fatty acid binding protein family FABP5 Fatty acid binding protein epidermal Q01469 CHEMBL3674
Therapeutic Target Lyase CA4 Carbonic anhydrase IV P22748 CHEMBL3729
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Metallo protease MMP12 Matrix metalloproteinase 12 P39900 CHEMBL4393
Therapeutic Target Nuclear hormone receptor subfamily 1 PPARA Peroxisome proliferator-activated receptor alpha Q07869 CHEMBL239
Therapeutic Target Oxidoreductase ALOX15 Arachidonate 15-lipoxygenase P16050 CHEMBL2903
Therapeutic Target Protein Kinase MKNK2 MAP kinase signal-integrating kinase 2 Q9HBH9 CHEMBL4204
Therapeutic Target Protein Kinase FLT3 Tyrosine-protein kinase receptor FLT3 P36888 CHEMBL1974
Therapeutic Target Protein Kinase MKNK1 MAP kinase-interacting serine/threonine-protein kinase MNK1 Q9BUB5 CHEMBL4718
Therapeutic Target Serine protease DPP4 Dipeptidyl peptidase IV P27487 CHEMBL284
Therapeutic Target Small molecule receptor (family A GPCR) FFAR4 G-protein coupled receptor 120 Q5NUL3 CHEMBL5339
Therapeutic Target Small molecule receptor (family A GPCR) FFAR1 Free fatty acid receptor 1 O14842 CHEMBL4422
Therapeutic Target Structural protein LMNA Prelamin-A/C P02545 CHEMBL1293235
Therapeutic Target Transcription factor NFE2L2 Nuclear factor erythroid 2-related factor 2 Q16236 CHEMBL1075094
Therapeutic Target Transcription factor HIF1A Hypoxia-inducible factor 1 alpha Q16665 CHEMBL4261
Therapeutic Target Transcription factor TP53 Cellular tumor antigen p53 P04637 CHEMBL4096
Therapeutic Target Transcription factor NFKB1 Nuclear factor NF-kappa-B p105 subunit P19838 CHEMBL3251
Therapeutic Target Transferase TNKS Tankyrase-1 O95271 CHEMBL6164
Therapeutic Target Transferase TNKS2 Tankyrase-2 Q9H2K2 CHEMBL6154
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level32
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT05014906 Efficacy of Oral Minocycline (Solodyn) and Oral Minocycline (Solodyn) Plus Azelaic Acid (Finacea) for Acne Rosacea rosacea Azelaic Acid (NPC214610) NP level
NCT00031096 Comparison of Efficacy and Safety of Azelaic Acid 15% Gel With Its Vehicle in Subjects With Mild to Moderate Acne acne Azelaic Acid (NPC214610) NP level
NCT01025635 Safety and Efficacy of Azelaic Acid Foam, 15% in Papulopustular Rosacea rosacea Azelaic Acid (NPC214610) NP level
NCT00607945 Dietary Fatty Acids as Complementary Therapy in Type 2 Diabetes Mellitus type 2 diabetes mellitus Linoleic Acid (NPC85813) NP level
NCT02147691 Finacea 15% and Brimonidine 0.33% Gel in the Treatment of Rosacea - A Pilot Study rosacea Azelaic Acid (NPC214610) NP level
NCT00403949 A Study of Azelaic Acid (AzA) 15% in Topical Treatment of Mild to Moderate Perioral Dermatitis Dermatitis, Perioral Azelaic Acid (NPC214610) NP level
NCT03418610 Azelaic Acid Foam 15% in the Treatment of Papulopustular Rosacea rosacea Azelaic Acid (NPC214610) NP level
NCT00908791 Proof of Principle Trial to Determine if Nutritional Supplement Conjugated Linoleic Acid (CLA) Can Modulate the Lipogenic Pathway in Breast Cancer Tissue breast cancer Linoleic Acid (NPC85813) NP level
NCT00617903 Exploration of Safety and Efficacy of AzA 15% Foam Twice a Day in Rosacea rosacea Azelaic Acid (NPC214610) NP level
NCT01387048 Study for Long-term Treatment of Acne Vulgaris With Skinoren Versus Differin acne Azelaic Acid (NPC214610) NP level
NCT03689010 To Evaluate the Therapeutic Equivalence and Safety in Treatment of Moderate Facial Rosacea rosacea Azelaic Acid (NPC214610) NP level
NCT00855595 Efficacy of Topical Azelaic Acid 15% Gel Plus Anti-inflammatory Dose Doxycycline or Metronidazole Gel 1% Plus Anti-inflammatory Dose Doxycycline in Moderate Papulopustular Rosacea rosacea Azelaic Acid (NPC214610) NP level
NCT01792310 A Phase 1/2A Study of LAM561 in Adult Patients With Advanced Solid Tumours glioma Oleic Acid (NPC261831) NP level
NCT02063802 Metformin vs Conjugated Linoleic Acid and an Intervention Program With Healthy Habits in Obese Children obesity Linoleic Acid (NPC85813) NP level
NCT02120924 A Study to Evaluate the Safety and Clinical Study of Azelaic Acid Gel 15% in Patients With Moderate Facial Rosacea rosacea Azelaic Acid (NPC214610) NP level
NCT00408330 A Study of Azelaic Acid (AzA) 15% Gel in the Treatment of Seborrheic Dermatitis of the Face seborrheic dermatitis Azelaic Acid (NPC214610) NP level
NCT00029679 Borage Oil and Ginkgo Biloba (EGb 761) in Asthma asthma Linoleic Acid (NPC85813) NP level
NCT01015521 Efficacy Study of Aminoflavone Prodrug to Treat Breast Cancer breast neoplasm Flavone (NPC32298) NP level
NCT03094403 To Evaluate the Therapeutic Equivalence and Safety of Azelaic Acid 15% Topical Gel rosacea Azelaic Acid (NPC214610) NP level
NCT00638196 Placebo vs. Linoleic Acid Controlled Assessment of Treatment Efficacy in MS multiple sclerosis Oleic Acid (NPC261831) NP level
NCT01494467 Phase 3 Papulopustular Rosacea Study rosacea Azelaic Acid (NPC214610) NP level
NCT00951158 A Molecular Pharmacodynamic Dose-titration Trial of Conjugated Linoleic Acid (CLA; Clarinol®) in Patients With Advanced Solid Tumors neoplasm Linoleic Acid (NPC85813) NP level
NCT01661764 Fish Oil Supplementation, Nutrigenomics and Colorectal Cancer Prevention colorectal adenoma Oleic Acid (NPC261831) NP level
NCT01555463 Safety and Efficacy of Azelaic Acid Foam, 15 % in Papulopustular Rosacea rosacea Azelaic Acid (NPC214610) NP level
NCT01493687 Phase 3 Papulopustular Rosacea Study rosacea Azelaic Acid (NPC214610) NP level
NCT00204932 Effects of CLA Supplements on Body Weight and Fat Oxidation obesity Linoleic Acid (NPC85813) NP level
NCT03035955 Azelaic Acid on Demodex Counts in Rosacea rosacea Azelaic Acid (NPC214610) NP level
NCT00417937 A Multicenter Trial of a Topical Medication for Papulopustular Rosacea Applied Twice Daily Versus Once Daily rosacea Azelaic Acid (NPC214610) NP level
NCT02800148 Bioequivalence Study of Two Treatments in the Treatment of Inflammatory Lesions of Rosacea on the Face rosacea Azelaic Acid (NPC214610) NP level
NCT02058628 Comparison of the Efficacy and Safety of Clindamycin + Benzoyl Peroxide Formulation With Azelaic Acid Formulation in the Treatment of Acne Vulgaris acne Azelaic Acid (NPC214610) NP level
NCT03287791 A Study to Evaluate Safety and Equivalence of Generic Azelaic Acid Foam and Finacea® Foam in Participants With Rosacea rosacea Azelaic Acid (NPC214610) NP level
NCT01257919 Safety and Pharmacokinetics of Azelaic Acid Foam, 15% in Papulopustular Rosacea rosacea Azelaic Acid (NPC214610) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 CSNK2A3,TP53,NOX4,CA4,HIF1A,MMP12,FABP5,AKR1B1,LMNA
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 NOX4,CA4,MMP12,FABP5,CA12,AKR1B1,FABP3,FABP4,TRIM24
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CYP1B1,GABRA6,CA7,XDH,NOX4,MMP12,DPP4,FFAR1,CA12
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 XDH,NOX4,FABP3,CA4,HIF1A,FABP5,DPP4,CA12,AKR1B1
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 CA7,NOX4,CA4,MMP12,FABP5,DPP4,FFAR1,CA12,FABP3
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA4,MKNK2,NFE2L2,MKNK1,CA12
 NCT00908791
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 XDH,FABP5,FFAR4,MMP12,FABP5,FFAR4
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CYP1B1,CSNK2A3,FABP5,DPP4,CA12,LMNA
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 DPP4,FLT3,NFKB1
 MMP12,FABP5
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 NFKB1,DPP4,PPARA,FFAR1
 NCT00607945
Colorectal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B91
 TP53,FLT3,MKNK1,MKNK2
 NCT01661764
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 XDH,NOX4,CA4,MMP12,FABP5
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 NOX4,FLT3,MMP12,DPP4,AKR1B1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CA7,XDH,MMP12,AKR1C3,CA12
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA7,XDH,MMP12,AKR1C3,CA12
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 FLT3,NFKB1,GSK3B,TP53
Ovarian cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73
 TNKS,TNKS2,TP53,FLT3
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 AKR1B1,PPARA,DPP4,FFAR1
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 NOX4,MMP12,AKR1C3,FABP4
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 XDH,MMP12,AKR1C3,CA12
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 FABP3,LMNA,DPP4,CA4
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 XDH,MMP12,CYP1A1,ALOX15
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 XDH,HIF1A,FFAR1,LMNA
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 CYP1B1,NOX4,DPP4,FFAR4
Asthma
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA23
 CA4,MMP12
 NCT00029679
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 DPP4,PPARA,NFKB1
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 MKNK2,HIF1A,MKNK1
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 CA4,AKR1B1,NFE2L2
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA4,CA12
 NCT00408330
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 FLT3,TP53,DPP4
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 CSNK2A1,MKNK1,MKNK2
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 NFE2L2,FLT3,MMP12
Non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92
 PPARA,NFE2L2
 FABP4
Acne vulgaris
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED80
 NCT00031096,NCT01387048,NCT02058628
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 NOX4,MMP12,ALOX15
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 NOX4,MMP12,CYP1A1
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 NOX4,FFAR1,FABP3
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 NOX4,MMP12,ALOX15
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 NOX4,FABP5,ALOX15
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CYP1A2,CYP1A1,CA12
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 NOX4,MMP12,AKR1C3
Myeloproliferative neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A20
 FLT3,GSK3B
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 TP53,DPP4
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 TP53,HIF1A
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 NFE2L2,HIF1A
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA12,CA4
Multiple sclerosis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A40
 NFKB1
 NCT00638196
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 NFKB1,AKR1B1
Peritoneal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C51
 FLT3,TP53
Idiopathic interstitial pneumonitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03
 FFAR1,FLT3
Gout
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA25
 PPARA,XDH
Obesity
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B80-5B81
 NCT00204932,NCT02063802
Inflammatory bowel diseases, unspecified
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD7Z
 MMP12,NOX4
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 NFKB1,DPP4
Pneumonia due to Pseudomonasaeruginosa
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.05
 MMP12,DPP4
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CYP1A2,AKR1B1
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CYP1A1,ALOX15
Systemic sclerosis
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A42
 FABP4,NOX4
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 MMP12,CYP1A1
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 CYP1A1,FFAR1
Polycystic ovary syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80.1
 MMP12,FFAR4
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 MMP12,CA12
Human immunodeficiency virus disease without mention of tuberculosis or malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C62
 FLT3,FFAR1
Rosacea
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED90
 NCT00617903,NCT02120924,NCT03035955,NCT03418610,NCT03094403,NCT03287791,NCT01494467,NCT02147691,NCT00417937,NCT01257919,NCT01493687,NCT03689010,NCT00855595,NCT02800148,NCT01025635,NCT05014906,NCT01555463
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 CSNK2A1,PPARA,GSK3B,MKNK2,HIF1A,CA4,CA12,NFKB1,FLT3,XDH,TP53,MKNK1
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 TP53,NOX4,FABP3,PPARA,FABP5,FFAR1,CA12,AKR1B1,LMNA,FABP4,TRIM24,CSNK2A2
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CSNK2A3,TP53,XDH,NOX4,FABP3,CYP1A2,MMP12,FABP5,FFAR4,CA12,ALOX15
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CYP1B1,CA7,XDH,FABP3,HIF1A,NFE2L2,DPP4,FFAR4,ALOX15,LMNA,AKR1C3
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CA7,XDH,FFAR1,FLT3,MMP12,DPP4,FFAR4,CA12,ALOX15,LMNA,CSNK2A2
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 NOX4,CA4,MMP12,AKR1C3,FABP5,CA12,FABP4,MMP12,CA12,AKR1C3,TRIM24
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 TP53,CA7,XDH,MMP12,FABP5,DPP4,ALOX15,FFAR4,AKR1B1,FFAR1
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 CYP1B1,NFKB1,FLT3,MMP12,FABP5,DPP4,ALOX15,FFAR4,AKR1B1,TRIM24
Dyslipidemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80-5C81
 PPARA
Liposarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B59
 TP53
BCR-ABL1-negative chronic myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A41
 FLT3
Choreiform disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A01
 NFKB1
Urinary system clinical sympton
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MF8Y
 NFE2L2
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 XDH
Metastatic liver/bile duct neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D80
 TP53
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 AKR1B1
Inborn purine/pyrimidine/nucleotide metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C55
 XDH
Esophageal cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 TP53
Bone/articular cartilage neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F7B
 FLT3
Mastocytosis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A21
 FLT3
Myotonic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71
 GSK3B
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 AKR1B1
Fungal infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F29-1F2F
 NFKB1
Kidney failure
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB60-GB6Z
 TP53
Ovarian dysfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80
 TP53
Skin and skin-structure infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F28-1G0Z
 NFKB1
Cardiovascular disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00-BE2Z
 PPARA
Chronic pain
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG30
 FLT3
Human immunodeficiency virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1C60-1C62
 FLT3
Endometrial cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76
 TP53
Mental/behavioural/neurodevelopmental disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6E20-6E8Z
 NFE2L2
Chronic myelomonocytic leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A40
 FLT3
Lip/oral cavity/pharynx neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B6E
 TP53
Mature B-cell leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A82
 TP53
Diffuse large B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 FLT3
Cervical cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C77
 TP53
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 TP53
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 DPP4
Chronic kidney disease
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GB61
 XDH
Cataract
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B10
 AKR1B1
NA
Disease Category: NA
Disease ICD-11 Code: NA
 NOX4
Encephalopathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8E47
 XDH
Mineral deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5B5K
 XDH
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 AKR1C3
Muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70
 NFKB1
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 DPP4
Ataxic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A03
 NFE2L2
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 NFE2L2
Unspecified viral infection of unspecified site
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D9Z
 FLT3
Phakomatoses/hamartoneoplastic syndrome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD2D
 FLT3
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 MMP12
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 GSK3B
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 FLT3
Hyper-lipoproteinaemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 PPARA
Influenza
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1E30-1E32
 XDH
Fragile X chromosome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD55
 GSK3B
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 NFKB1
Adrenomedullary hyperfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A75
 HIF1A
Osteosarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B51
 GSK3B
Fallopian tube cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C74
 TP53
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 AKR1B1
Female pelvic pain
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA34
 AKR1C3
Irritable bowel syndrome
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD91
 NFKB1
Subarachnoid haemorrhage
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B01
 NFE2L2
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 TP53
Inborn lipid metabolism error
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C52
 PPARA
Hyperlipidemia
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C80
 PPARA
Coronavirus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D92
 CSNK2A1
Inflammatory arthropathy
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA2Z
 FLT3
Autism spectrum disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02
 DPP4
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 AKR1B1
Bladder cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94
 TP53
Head and neck cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D42
 TP53
Indeterminate colitis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD72
 NFKB1
Acute/subacute hepatic failure
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB91
 NFKB1
Transplanted organ/tissue
Disease Category: 24.Factors influencing health status or contact with health services
Disease ICD-11 Code: QB63
 FLT3
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 TP53
Mature B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A85
 FLT3
Transplant rejection
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE84
 TP53
Multiple myeloma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A83
 FLT3
Macular degeneration
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B75
 NFE2L2
Lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40
 NFKB1
Neoplasms of unknown behaviour of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F95
 NCT01015521
Periorificial dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED90.1
 NCT00403949
Neoplasms
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 02
 NCT00951158
Glioma, malignant
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH4RQ3
 NCT01792310
Crohn disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD70
 MMP12
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12
Idiopathic pulmonary fibrosis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CB03.4
 MMP12
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1
Malignant neoplasms of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94
 FABP4
Keratoconus
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9A78.50
 CA4
Pre-eclampsia
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA24
 CA4
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 CA4
Malignant neoplasms of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 FABP4
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1
Malignant neoplasm of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 FABP4

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group