• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Thymus Quinquecostatus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCTTTAAAAACAGACCGCGAACACGTGTTTAACACCGTTGGGACGGTGCGGGGGGTAACCCTCTGCCGTGTCCCATCTCCTGCCGGCGTGTACCTTCGGGTACGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACAAAACGAAGCGTTCCCCCTGGCATCCCGTTCGCGGAGTGTGCTGGGGGAGCAGACGTCTATCAAATGTCAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCTTCCCGTGCTGAATGCCGGGCGGTCGGGGGCGGACATTGGCCTCCCGTGCACCTCCGTGCGGGCTGGCCCAAATGCGATCCCCGGGCGACTGGCGTCACGACAAGTGGTGGTTGAACATCCAATCTCTCTCGTCGTCGAGCCGTCCTGGGGACATAAAGGGAATAGTCATGAAAGACCATAAGGGGAGGGTGGAAGTAAAAGTTGACCAAGGCATTCAAAAGCGGCGAT

Click for details-----ITS1

TCGAACCTTTAAAAACAGACCGCGAGCACGTGTTTAACACCGTTGGGGACGGTGCGGGGGGTAACCCTCTGCCGTGTCCCATCTCCTGCCGGCGTGTACCTTCGGGTCACGTCGTGCGGGCTAACGAACCCCGGCGCGGAATGCGCCAAGGAAAACAAAACGAAGCGTTTCCCCCTGGCATCCCATTCGCGGAGTGTGCTGGGGGAGCAGACGTCTATCAAATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCTTCCCGTGCTGAATGCCGGGCGGTCGGGGGCGGACATTGGCCTCCCGTGCACCTCCGTGCGGGCTGGCCCAAATGCGATCCCCGGGCGACTGGCGTCACGACAAGTGGTGGTTGAACATCCAATCTCTCTCGTCGTCGAGCCGTCCTGGGGACATAAAGGGAATAGTCATGAAAGACCATAAGGGGAGGGTGGAAGTAAAAGTTGACCAAGGCATTCAAAAGCGGCGAT
Taxonomic Information

Plant ID: NPO12935
Plant Latin Name: Thymus Quinquecostatus
Taxonomy Genus: Thymus
Taxonomy Family: Lamiaceae

Plant External Links:

NCBI TaxonomyDB: 228974
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Antiseptic; Deodorant; Disinfectant

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

296 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


238 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

158 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC9880

Ingredient ID: NPC97811

Ingredient ID: NPC97192

Ingredient ID: NPC96630

Ingredient ID: NPC9424

Ingredient ID: NPC92869

Ingredient ID: NPC92774

Ingredient ID: NPC91574

Ingredient ID: NPC90701

Ingredient ID: NPC89391

Ingredient ID: NPC89069

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC85473

Ingredient ID: NPC84994

Ingredient ID: NPC84030

Ingredient ID: NPC83473

Ingredient ID: NPC82422

Ingredient ID: NPC81775

Ingredient ID: NPC81010

Ingredient ID: NPC80090

Ingredient ID: NPC79943

Ingredient ID: NPC7965

Ingredient ID: NPC79056

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC7491

Ingredient ID: NPC7314

Ingredient ID: NPC71853

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC70744

Ingredient ID: NPC68889

Ingredient ID: NPC67986

Ingredient ID: NPC66577

Ingredient ID: NPC64176

Ingredient ID: NPC64018

Ingredient ID: NPC61506

Ingredient ID: NPC61477

Ingredient ID: NPC61373

Ingredient ID: NPC61

Ingredient ID: NPC60556

Ingredient ID: NPC60288

Ingredient ID: NPC59570

Ingredient ID: NPC58970

Ingredient ID: NPC57877

Ingredient ID: NPC57234

Ingredient ID: NPC56505

Ingredient ID: NPC54264

Ingredient ID: NPC52230

Ingredient ID: NPC51189

Ingredient ID: NPC50898

Ingredient ID: NPC50026

Ingredient ID: NPC49074

Ingredient ID: NPC47946

Ingredient ID: NPC47781

Ingredient ID: NPC46248

Ingredient ID: NPC45727

Ingredient ID: NPC45561

Ingredient ID: NPC45540

Ingredient ID: NPC45270

Ingredient ID: NPC44751

Ingredient ID: NPC44671

Ingredient ID: NPC44328

Ingredient ID: NPC43822

Ingredient ID: NPC43114

Ingredient ID: NPC41865

Ingredient ID: NPC41180

Ingredient ID: NPC4079

Ingredient ID: NPC40249

Ingredient ID: NPC39360

Ingredient ID: NPC38751

Ingredient ID: NPC36835

Ingredient ID: NPC3649

Ingredient ID: NPC36125

Ingredient ID: NPC34764

Ingredient ID: NPC34520

Ingredient ID: NPC33909

Ingredient ID: NPC32977

Ingredient ID: NPC32441

Ingredient ID: NPC3155

Ingredient ID: NPC312800

Ingredient ID: NPC312132

Ingredient ID: NPC311485

Ingredient ID: NPC310214

Ingredient ID: NPC309182

Ingredient ID: NPC308218

Ingredient ID: NPC306990

Ingredient ID: NPC303611

Ingredient ID: NPC302950

Ingredient ID: NPC302857

Ingredient ID: NPC301195

Ingredient ID: NPC300649

Ingredient ID: NPC29883

Ingredient ID: NPC297643

Ingredient ID: NPC29710

Ingredient ID: NPC296337

Ingredient ID: NPC294902

Ingredient ID: NPC294852

Ingredient ID: NPC294136

Ingredient ID: NPC293454

Ingredient ID: NPC292293

Ingredient ID: NPC290843

Ingredient ID: NPC290638

Ingredient ID: NPC290515

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC289366

Ingredient ID: NPC287550

Ingredient ID: NPC287335

Ingredient ID: NPC287331

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC282305

Ingredient ID: NPC281020

Ingredient ID: NPC280760

Ingredient ID: NPC279121

Ingredient ID: NPC278068

Ingredient ID: NPC273607

Ingredient ID: NPC27184

Ingredient ID: NPC271321

Ingredient ID: NPC26960

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC268564

Ingredient ID: NPC265885

Ingredient ID: NPC26524

Ingredient ID: NPC261619

Ingredient ID: NPC260491

Ingredient ID: NPC259512

Ingredient ID: NPC257124

Ingredient ID: NPC255577

Ingredient ID: NPC255042

Ingredient ID: NPC254770

Ingredient ID: NPC254156

Ingredient ID: NPC250539

Ingredient ID: NPC249815

Ingredient ID: NPC249801

Ingredient ID: NPC249018

Ingredient ID: NPC246543

Ingredient ID: NPC245858

Ingredient ID: NPC24327

Ingredient ID: NPC240476

Ingredient ID: NPC239039

Ingredient ID: NPC239037

Ingredient ID: NPC236355

Ingredient ID: NPC234990

Ingredient ID: NPC234113

Ingredient ID: NPC233443

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC23145

Ingredient ID: NPC230468

Ingredient ID: NPC229262

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC226778

Ingredient ID: NPC226096

Ingredient ID: NPC225953

Ingredient ID: NPC225783

Ingredient ID: NPC225710

Ingredient ID: NPC22484

Ingredient ID: NPC223468

Ingredient ID: NPC222997

Ingredient ID: NPC222001

Ingredient ID: NPC220860

Ingredient ID: NPC219876

Ingredient ID: NPC218918

Ingredient ID: NPC21890

Ingredient ID: NPC218357

Ingredient ID: NPC216630

Ingredient ID: NPC216330

Ingredient ID: NPC216162

Ingredient ID: NPC215632

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC214321

Ingredient ID: NPC213749

Ingredient ID: NPC21266

Ingredient ID: NPC211992

Ingredient ID: NPC211493

Ingredient ID: NPC210003

Ingredient ID: NPC209275

Ingredient ID: NPC208151

Ingredient ID: NPC20791

Ingredient ID: NPC20742

Ingredient ID: NPC20505

Ingredient ID: NPC20094

Ingredient ID: NPC197977

Ingredient ID: NPC197942

Ingredient ID: NPC196490

Ingredient ID: NPC193872

Ingredient ID: NPC19319

Ingredient ID: NPC190810

Ingredient ID: NPC189036

Ingredient ID: NPC188238

Ingredient ID: NPC187913

Ingredient ID: NPC187796

Ingredient ID: NPC187061

Ingredient ID: NPC185377

Ingredient ID: NPC184400

Ingredient ID: NPC184049

Ingredient ID: NPC182840

Ingredient ID: NPC182727

Ingredient ID: NPC182102

Ingredient ID: NPC181465

Ingredient ID: NPC180871

Ingredient ID: NPC18074

Ingredient ID: NPC180684

Ingredient ID: NPC179950

Ingredient ID: NPC178223

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC176740

Ingredient ID: NPC176309

Ingredient ID: NPC175987

Ingredient ID: NPC175913

Ingredient ID: NPC175108

Ingredient ID: NPC173996

Ingredient ID: NPC173582

Ingredient ID: NPC168855

Ingredient ID: NPC168620

Ingredient ID: NPC168552

Ingredient ID: NPC167976

Ingredient ID: NPC166894

Ingredient ID: NPC166788

Ingredient ID: NPC166362

Ingredient ID: NPC165951

Ingredient ID: NPC1656

Ingredient ID: NPC164514

Ingredient ID: NPC163984

Ingredient ID: NPC16157

Ingredient ID: NPC161555

Ingredient ID: NPC160924

Ingredient ID: NPC158537

Ingredient ID: NPC156654

Ingredient ID: NPC154650

Ingredient ID: NPC152964

Ingredient ID: NPC150329

Ingredient ID: NPC14949

Ingredient ID: NPC14917

Ingredient ID: NPC147343

Ingredient ID: NPC14682

Ingredient ID: NPC14576

Ingredient ID: NPC144023

Ingredient ID: NPC143639

Ingredient ID: NPC143292

Ingredient ID: NPC141777

Ingredient ID: NPC140689

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC138347

Ingredient ID: NPC138113

Ingredient ID: NPC13789

Ingredient ID: NPC137201

Ingredient ID: NPC135257

Ingredient ID: NPC135077

Ingredient ID: NPC133671

Ingredient ID: NPC133162

Ingredient ID: NPC131981

Ingredient ID: NPC131769

Ingredient ID: NPC131292

Ingredient ID: NPC130931

Ingredient ID: NPC128863

Ingredient ID: NPC12870

Ingredient ID: NPC126240

Ingredient ID: NPC126029

Ingredient ID: NPC125017

Ingredient ID: NPC124876

Ingredient ID: NPC122962

Ingredient ID: NPC122487

Ingredient ID: NPC122235

Ingredient ID: NPC121373

Ingredient ID: NPC121322

Ingredient ID: NPC120926

Ingredient ID: NPC119949

Ingredient ID: NPC118909

Ingredient ID: NPC117493

Ingredient ID: NPC116775

Ingredient ID: NPC114992

Ingredient ID: NPC114239

Ingredient ID: NPC113367

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC109813

Ingredient ID: NPC108606

Ingredient ID: NPC1075

Ingredient ID: NPC106250

Ingredient ID: NPC102449

Ingredient ID: NPC102091

Ingredient ID: NPC101285

Ingredient ID: NPC100616

Ingredient ID: NPC100502

Ingredient ID: NPC100445