• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Polianthes Tuberosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGTTAACGCATCCGACGGGGGCGGGTGTGGGCGACATTTGCCGCCCGCCGCCTGCCCCCTCGGGGGCACCCTGGCTGCCCCCGCCTTGCCTTGCTGCGGGGTGGGGGCCGCGAACAACACCGGGCGCGGTGGGCGCCAAGGAACAGTGCTTCTGGAGAGCAGCGTGCGTCGGACCGCCAAGGTGGGAAAGGCGCACGATGCGATCCTGCAATATCGTTAACTTTACGACTCTCGGCAACGGATATCTTGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCTCGCGTCGCTCCGCGCACCCTGCCCCCACCCAGAGCGGGCAGATGTGGGTGTGGATGTGGATATTGGCCCCCCGTGCCTTGCGGTGCGGCGGGTCGAAGTGCGGGCCGCCGGCCGGGTTGGACGCGGCGAGTGGTGGACGGACACGATTGACGCTGAACGCCGCGAACCAAGCCCCCGGCCTATGCGGCTCATGCAAGGAACCCAATCCGACTGGCGCTCACGAGCGCCCTCGGACAACGACCCCAGG

Click for details-----ITS1

TGTTAACGCATCCGACGGGGGCGGGTGTGGGCGACATTTGCCGCCCGCCGCCTGCCCCCTCGGGGGCACCCTGGCTGCCCCCGCCTTGCCTTGCTGCGGGGTGGGGGCCGCGAACAACACCGGGCGCGGTGGGCGCCAAGGAACAGTGCTTCTGGAGAGCAGCGTGCGTCGGACCGCCAAGGTGGGAAAGGCGCACGATGCGATCCTGCAATATCGTTAACTTTA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO12929
Plant Latin Name: Polianthes Tuberosa
Taxonomy Genus: Polianthes
Taxonomy Family: Asparagaceae

Plant External Links:

NCBI TaxonomyDB: 82206
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

99 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

27 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98549

Ingredient ID: NPC94610

Ingredient ID: NPC94086

Ingredient ID: NPC94072

Ingredient ID: NPC92890

Ingredient ID: NPC92297

Ingredient ID: NPC8943

Ingredient ID: NPC87009

Ingredient ID: NPC84111

Ingredient ID: NPC82136

Ingredient ID: NPC79340

Ingredient ID: NPC73532

Ingredient ID: NPC69460

Ingredient ID: NPC64469

Ingredient ID: NPC60120

Ingredient ID: NPC476112

Ingredient ID: NPC475625

Ingredient ID: NPC473817

Ingredient ID: NPC473505

Ingredient ID: NPC45077

Ingredient ID: NPC44758

Ingredient ID: NPC44619

Ingredient ID: NPC40465

Ingredient ID: NPC3994

Ingredient ID: NPC33747

Ingredient ID: NPC32104

Ingredient ID: NPC310038

Ingredient ID: NPC308485

Ingredient ID: NPC307534

Ingredient ID: NPC305771

Ingredient ID: NPC30565

Ingredient ID: NPC300928

Ingredient ID: NPC289754

Ingredient ID: NPC287483

Ingredient ID: NPC286941

Ingredient ID: NPC2859

Ingredient ID: NPC284104

Ingredient ID: NPC2818

Ingredient ID: NPC276919

Ingredient ID: NPC273002

Ingredient ID: NPC269513

Ingredient ID: NPC269184

Ingredient ID: NPC263641

Ingredient ID: NPC263344

Ingredient ID: NPC26272

Ingredient ID: NPC253628

Ingredient ID: NPC250290

Ingredient ID: NPC246162

Ingredient ID: NPC244871

Ingredient ID: NPC243320

Ingredient ID: NPC240645

Ingredient ID: NPC23811

Ingredient ID: NPC234962

Ingredient ID: NPC233433

Ingredient ID: NPC232037

Ingredient ID: NPC231435

Ingredient ID: NPC230894

Ingredient ID: NPC229177

Ingredient ID: NPC227889

Ingredient ID: NPC226642

Ingredient ID: NPC224631

Ingredient ID: NPC223081

Ingredient ID: NPC221691

Ingredient ID: NPC220836

Ingredient ID: NPC220644

Ingredient ID: NPC21165

Ingredient ID: NPC210582

Ingredient ID: NPC209647

Ingredient ID: NPC203536

Ingredient ID: NPC203155

Ingredient ID: NPC202291

Ingredient ID: NPC198079

Ingredient ID: NPC197544

Ingredient ID: NPC190870

Ingredient ID: NPC190764

Ingredient ID: NPC190302

Ingredient ID: NPC184617

Ingredient ID: NPC184181

Ingredient ID: NPC179594

Ingredient ID: NPC178795

Ingredient ID: NPC174186

Ingredient ID: NPC169816

Ingredient ID: NPC168397

Ingredient ID: NPC15918

Ingredient ID: NPC153283

Ingredient ID: NPC150324

Ingredient ID: NPC147680

Ingredient ID: NPC135846

Ingredient ID: NPC132739

Ingredient ID: NPC132080

Ingredient ID: NPC128927

Ingredient ID: NPC124479

Ingredient ID: NPC124349

Ingredient ID: NPC12349

Ingredient ID: NPC12332

Ingredient ID: NPC121589

Ingredient ID: NPC113385

Ingredient ID: NPC108435

Ingredient ID: NPC108151