• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Citrus Aurantiifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AAGGATCATTGTCGAATCCCGCAACGAGCAGACCGCGCACACGTATATGCTGCACGGGGCGCCCGATGGGAAGGTGCGCGCGCGCCTCCCGCGGGTTGCCCCCGCGCCCCGCCCGACCCTCGAGCGAGCGAGTGCAACAGGCGGGGCCATCAACAGACCCACGGCGCATTACGGCGCCAAGGACCACAAACGCGGAGGGTTGCCCCCGTCGTGCACCCGTTCGCGGTGTGCCGTTCGGGGGATGTGCGCCTCCCAAGATTGCATACGGAAAAAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCTGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCTCCGCGCCCACCTCCCCACCCGGGGGCGGGGGATGCGGGGCGGAGATTGGTCTCCCGTGCGCCCGGCGCGCGGATGGCTAAAATGGGATCCCTCGGCGACGCACGTCACGGCCATTGGTGGTTGATCTCATCAGCCGACTCGTGTGTGGCTGTGCTCCTCTGCGTCGCTCGCGAGGGCATCCGAGCGTACCCAACGGCGCCTGGCGCCAGCATCCGCGACCCCA

Click for details-----ITS1

AAGGATCATTGTCGAATCCCGCAACGAGCAGACCGCGCACACGTATATGCTGCACGGGGCGCCCGATGGGAAGGTGCGCGCGCGCCTCCCGCGGGTTGCCCCCGCGCCCCGCCCGACCCTCGAGCGAGCGAGTGCAACAGGCGGGGCCATCAACAGACCCACGGCGCATTACGGCGCCAAGGACCACAAACGCGGAGGGTTGCCCCCGTCGTGCACCCGTTCGCGGTGTGCCGTTCGGGGGATGTGCGCCTCCCAAGATTGCATACGGAAAAAA

Click for details-----ITS2

ATCGCATCACCCCTTCCCCTATACTGGTGGATGGGGTGGAATGTGACCTCCTGTGCCTAGAGTGCAGCTGGTCAAAATTTGAGTCCGGAACGTAGGATATCACGGCAAGTGGTGGTTGGACAACAACTCGCGTCCTGTCGTGTGCCGAACCTCCAGTGATTATCAAGACCCTAAGGCACATGATACCATAATCTGTGGAAAACTTGTGTTACGACCGCGACCCCAGGTCAGGCGGGATAGGAAACTACTAGT
Taxonomic Information

Plant ID: NPO12807
Plant Latin Name: Citrus Aurantiifolia
Taxonomy Genus: Citrus
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 159033
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil; Tanzania; Indonesia; India; Burkina Faso; Togo; Rwanda; Kenya; Thailand; Nigeria; Iraq; Philippines

Traditional Medicine System:
Indian Folk; Unani; Ayurveda; Siddha

Geographical Distribution

Brazil; Philippines; Indonesia; India; Togo; Rwanda; Tanzania; Thailand; Kenya; Nigeria; Iraq; Burkina Faso

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

160 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


118 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

80 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC98748

Ingredient ID: NPC97130

Ingredient ID: NPC9575

Ingredient ID: NPC94167

Ingredient ID: NPC88566

Ingredient ID: NPC88080

Ingredient ID: NPC86856

Ingredient ID: NPC86545

Ingredient ID: NPC85940

Ingredient ID: NPC85813

Ingredient ID: NPC84488

Ingredient ID: NPC82843

Ingredient ID: NPC82648

Ingredient ID: NPC79943

Ingredient ID: NPC79056

Ingredient ID: NPC78551

Ingredient ID: NPC76087

Ingredient ID: NPC71786

Ingredient ID: NPC66599

Ingredient ID: NPC60151

Ingredient ID: NPC57828

Ingredient ID: NPC55412

Ingredient ID: NPC54339

Ingredient ID: NPC49151

Ingredient ID: NPC490162

Ingredient ID: NPC489977

Ingredient ID: NPC489907

Ingredient ID: NPC43587

Ingredient ID: NPC424

Ingredient ID: NPC41851

Ingredient ID: NPC39373

Ingredient ID: NPC3649

Ingredient ID: NPC35912

Ingredient ID: NPC34764

Ingredient ID: NPC331113

Ingredient ID: NPC328447

Ingredient ID: NPC32441

Ingredient ID: NPC322415

Ingredient ID: NPC32110

Ingredient ID: NPC312366

Ingredient ID: NPC311131

Ingredient ID: NPC307928

Ingredient ID: NPC302950

Ingredient ID: NPC301696

Ingredient ID: NPC29638

Ingredient ID: NPC294548

Ingredient ID: NPC291124

Ingredient ID: NPC290319

Ingredient ID: NPC287331

Ingredient ID: NPC287293

Ingredient ID: NPC285038

Ingredient ID: NPC283712

Ingredient ID: NPC283316

Ingredient ID: NPC27640

Ingredient ID: NPC276227

Ingredient ID: NPC276009

Ingredient ID: NPC274302

Ingredient ID: NPC273641

Ingredient ID: NPC273385

Ingredient ID: NPC2728

Ingredient ID: NPC271270

Ingredient ID: NPC269919

Ingredient ID: NPC26906

Ingredient ID: NPC268664

Ingredient ID: NPC26600

Ingredient ID: NPC265934

Ingredient ID: NPC264908

Ingredient ID: NPC262505

Ingredient ID: NPC261831

Ingredient ID: NPC259512

Ingredient ID: NPC257191

Ingredient ID: NPC257188

Ingredient ID: NPC255850

Ingredient ID: NPC250088

Ingredient ID: NPC249078

Ingredient ID: NPC246721

Ingredient ID: NPC246679

Ingredient ID: NPC246165

Ingredient ID: NPC24506

Ingredient ID: NPC243359

Ingredient ID: NPC24327

Ingredient ID: NPC239790

Ingredient ID: NPC239000

Ingredient ID: NPC238107

Ingredient ID: NPC231938

Ingredient ID: NPC231183

Ingredient ID: NPC22945

Ingredient ID: NPC229262

Ingredient ID: NPC228568

Ingredient ID: NPC228166

Ingredient ID: NPC227986

Ingredient ID: NPC227237

Ingredient ID: NPC225783

Ingredient ID: NPC215671

Ingredient ID: NPC215632

Ingredient ID: NPC215161

Ingredient ID: NPC215012

Ingredient ID: NPC213749

Ingredient ID: NPC209137

Ingredient ID: NPC208198

Ingredient ID: NPC20791

Ingredient ID: NPC207087

Ingredient ID: NPC20476

Ingredient ID: NPC204042

Ingredient ID: NPC203468

Ingredient ID: NPC20258

Ingredient ID: NPC197122

Ingredient ID: NPC194754

Ingredient ID: NPC192402

Ingredient ID: NPC191463

Ingredient ID: NPC1909

Ingredient ID: NPC190771

Ingredient ID: NPC190270

Ingredient ID: NPC189436

Ingredient ID: NPC188674

Ingredient ID: NPC187770

Ingredient ID: NPC187223

Ingredient ID: NPC185541

Ingredient ID: NPC185538

Ingredient ID: NPC184220

Ingredient ID: NPC18205

Ingredient ID: NPC181366

Ingredient ID: NPC180871

Ingredient ID: NPC179897

Ingredient ID: NPC179831

Ingredient ID: NPC17810

Ingredient ID: NPC177303

Ingredient ID: NPC177112

Ingredient ID: NPC175987

Ingredient ID: NPC174927

Ingredient ID: NPC174911

Ingredient ID: NPC170967

Ingredient ID: NPC167400

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC164550

Ingredient ID: NPC163556

Ingredient ID: NPC158296

Ingredient ID: NPC152451

Ingredient ID: NPC150713

Ingredient ID: NPC149419

Ingredient ID: NPC147983

Ingredient ID: NPC146386

Ingredient ID: NPC144741

Ingredient ID: NPC144023

Ingredient ID: NPC141163

Ingredient ID: NPC140672

Ingredient ID: NPC14004

Ingredient ID: NPC138113

Ingredient ID: NPC135353

Ingredient ID: NPC130683

Ingredient ID: NPC127588

Ingredient ID: NPC112890

Ingredient ID: NPC110639

Ingredient ID: NPC107948

Ingredient ID: NPC106967

Ingredient ID: NPC105688

Ingredient ID: NPC101766

Ingredient ID: NPC100445