CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Rheum Hotaoense

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCGCGAGCAGACAGACCCGCGAACCCGTCTCTAACCCGCCGCCGGGGGGAGGGGATCGGGCTCTCTTCTGAGCCCCGCCCCCCTTCCCGGCGCGCGCCAACCAAACCCCGGCGCGGATTGCGCCAAGGACTATGAACAAGAGCGCGTCCCGCGCGCCCCGGCGCGCGTGCGACGTCGCGTCGTTTCTACCTAACAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGTCTGGGCGTCACGCACCACGTCGCCCCCGCCCCCTCCGGGGGGCAGGGGCGGAGACTGGCCCCCCGTGCGCCCCGGCGCGCGGCCGGCTAAACGCAGGCCCCGCGGCCGCGAGAAGCCGCGACGACTGGTGGTGTACTAGCGGCCCCGTGCCGCGAAGCATCGCGTCGCGTCTCGCGCGGCCACCGTGAGCGCCAAAAGGGTCCCGACCACCGTTGCG

Click for details-----ITS1

TCGAAACCTGCGCAAGCAGACAGACCCGCGAACCCGTCTCTAACCCGCCGCCGGGGGGGATCGGGCTCTCTTTTGAGTCCCCCCCTCCCGGCGCGCGCCAACCAAACCCCGGCGCGGATTGCGCCAAGGACTATGAACAAGAGCGCGTCCCGTGCGCCCCGGCGCGCGTGCGACGTCGCGTCGTTTTTACTTACAGAA

Click for details-----ITS2

ACCACGTCGCCCCCGCCCCCTCCGGGGGGCAGGGGCGGAGACTGGCCCCCCGTGCGCCCCGGCGCGCGGCCGGCTAAACGCAGGCCCCGCGGCCGCGAGAAGCCGCGACGACTGGTGGTGTACTAGCGGCCCCGTGCCGCGAAGCATCGCGTCGCGTCTCGCGCGGCCACCGTGAGCGCCAAAAGGGTCCCGACCACCGTTGCG

Taxonomic Information

Plant ID: NPO12761
Plant Latin Name: Rheum Hotaoense
Taxonomy Genus: Rheum
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 137217
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

24 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

16 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC81455

Ingredient ID: NPC73723

Ingredient ID: NPC67267

Ingredient ID: NPC55602

Ingredient ID: NPC47870

Ingredient ID: NPC44083

Ingredient ID: NPC32710

Ingredient ID: NPC297071

Ingredient ID: NPC28657

Ingredient ID: NPC285893

Ingredient ID: NPC284050

Ingredient ID: NPC255180

Ingredient ID: NPC253124

Ingredient ID: NPC248703

Ingredient ID: NPC230301

Ingredient ID: NPC225710

Ingredient ID: NPC207057

Ingredient ID: NPC162742

Ingredient ID: NPC146749

Ingredient ID: NPC140823

Ingredient ID: NPC126574

Ingredient ID: NPC118510

Ingredient ID: NPC113733

Ingredient ID: NPC106770

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Lysine demethylase	KDM4E	Lysine-specific demethylase 4D-like	B2RXH2	CHEMBL1293226
Therapeutic Target	Nuclear hormone receptor subfamily 1	RORC	Nuclear receptor ROR-gamma	P51449	CHEMBL1741186
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transferase	FUT7	Alpha-(1,3)-fucosyltransferase 7	Q11130	CHEMBL3596077

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	4

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00965068	Cholesterol in ASD: Characterization and Treatment	Asperger syndrome;autism	Cholesterol (NPC28657)	NP level
NCT04359823	DSAP Treatment Comparison	porokeratosis	Cholesterol (NPC28657)	NP level
NCT00009841	Gene Therapy in Treating Patients With Advanced Head and Neck Cancer	head and neck malignant neoplasia	Cholesterol (NPC28657)	NP level
NCT00272844	Treatment of the Cholesterol Defect in Smith-Lemli-Opitz Syndrome	Smith-Lemli-Opitz syndrome	Cholesterol (NPC28657)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	RORC,TDP1,FUT7,HSD17B10
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	RORC,TDP1,FUT7
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	TDP1,HSD17B10,LMNA
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	F2,FUT7,LMNA
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	TDP1,FUT7,LMNA
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	RORC,F2
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	RORC,FUT7
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2,RORC
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	F2,FUT7
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	FUT7,HSD17B10
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	F2,FUT7
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	RORC
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	RORC
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	F2
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	RORC
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	RORC
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	RORC
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	NCT00009841
Porokeratoses Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED52	NCT04359823
Autism spectrum disorder without disorder of intellectual development and with mild or no impairment of functional language Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02.0	NCT00965068
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	NCT00965068
Disorders of cholesterol synthesis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52.10	NCT00272844
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	FUT7
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	F2
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	F2
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	FUT7
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	KDM4E
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	F2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	FUT7
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	FUT7
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	FUT7
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	FUT7

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Rheum Hotaoense

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

24 All known Ingredients in Total

16 Ingredients with Acceptable Bioavailablity

11 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Diffuse large B-cell lymphomas

Adenocarcinoma of pancreas

Mesothelioma of pleura

Multiple sclerosis

Pheochromocytoma

Tetralogy of Fallot

Other specified malignant neoplasms of kidney, except renal pelvis

Malignant neoplasms of thymus

Germ cell tumour of testis

Cerebral ischaemic stroke

Angina pectoris

Thrombocytopenia

Ischaemic/haemorrhagic stroke

Psoriasis

Coronary thrombosis

Nutritional deficiency

Lung cancer

Type 2 diabetes mellitus

Thrombosis

Autoimmune disease

Cardiovascular disease

Crohn disease

Solid tumour/cancer

Bleeding disorder

Myocardial infarction

Coagulation defect

Asthma

Head and neck cancer

Porokeratoses

Autism spectrum disorder without disorder of intellectual development and with mild or no impairment of functional language

Autism spectrum disorder

Disorders of cholesterol synthesis

Malignant neoplasms of biliary tract, distal bile duct

Leishmaniasis

Adenocarcinoma of stomach

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Squamous cell carcinoma of bronchus or lung

Other specified malignant neoplasms ofcolon

Melanoma of skin

Superficial ovarian endometriosis

Cytomegaloviral disease

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Polycystic ovary syndrome

Invasive carcinoma of breast

Glioblastoma of brain

Carpal tunnel syndrome

Malignant neoplasms of adrenal gland

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities