CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Rheum Australe

Example Image

PLANiTS DNA barcode

ACCGCGTCGCCCCCGCCCCCCCCGGGGGGCAGGGGCGGAGACTGGCCCCCCGTGCGCCCCGGCGCGCGGCCGGCCTAAACGCAGGCCCCGCGGCCGCGAGAAGCCGCGACGATTGGTGGTGTACCAGCGGCCCCGTGCCGCGAAGCATCGCGTCGCGTCTCGCGCGGCCACCGGGAGCGCCAAAAGGGCCCCGACCACCGTTGCCACC

Taxonomic Information

Plant ID: NPO12759
Plant Latin Name: Rheum Australe
Taxonomy Genus: Rheum
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 284363
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

India

Traditional Medicine System:

Unani; Ayurveda; Siddha

Medicinal Functions:

Digestive; Purgative; Tonic

Geographical Distribution

India

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

37 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

14 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC95198

Ingredient ID: NPC92329

Ingredient ID: NPC82725

Ingredient ID: NPC8080

Ingredient ID: NPC7817

Ingredient ID: NPC71210

Ingredient ID: NPC70622

Ingredient ID: NPC64804

Ingredient ID: NPC6207

Ingredient ID: NPC60171

Ingredient ID: NPC58427

Ingredient ID: NPC5029

Ingredient ID: NPC46958

Ingredient ID: NPC45777

Ingredient ID: NPC38283

Ingredient ID: NPC3224

Ingredient ID: NPC312929

Ingredient ID: NPC311264

Ingredient ID: NPC310447

Ingredient ID: NPC310198

Ingredient ID: NPC310128

Ingredient ID: NPC285122

Ingredient ID: NPC280318

Ingredient ID: NPC278329

Ingredient ID: NPC265104

Ingredient ID: NPC254848

Ingredient ID: NPC253124

Ingredient ID: NPC243062

Ingredient ID: NPC225710

Ingredient ID: NPC219876

Ingredient ID: NPC21353

Ingredient ID: NPC210292

Ingredient ID: NPC205400

Ingredient ID: NPC16676

Ingredient ID: NPC157410

Ingredient ID: NPC142753

Ingredient ID: NPC111897

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Lysine demethylase	KDM4E	Lysine-specific demethylase 4D-like	B2RXH2	CHEMBL1293226
Therapeutic Target	Oxidoreductase	ALOX15	Arachidonate 15-lipoxygenase	P16050	CHEMBL2903
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transferase	FUT7	Alpha-(1,3)-fucosyltransferase 7	Q11130	CHEMBL3596077

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	HSD17B10,FUT7,ALOX15,TDP1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	ALOX15,FUT7,LMNA,TDP1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	ALOX15,FUT7,TDP1
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	HSD17B10,LMNA,TDP1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	ALOX15,FUT7,LMNA
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	HSD17B10,FUT7,ALOX15
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ALOX15,KDM4E
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	FUT7
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	FUT7
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	ALOX15
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	FUT7
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	FUT7
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ALOX15
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	ALOX15
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	ALOX15
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	FUT7
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	FUT7
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	FUT7
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	FUT7
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	FUT7

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Rheum Australe

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

37 All known Ingredients in Total

11 Ingredients with Acceptable Bioavailablity

14 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Carcinosarcoma of uterus

Mesothelioma of pleura

Serous cystadenoma,borderline malignancy of ovary

Diffuse large B-cell lymphomas

Adenocarcinoma of pancreas

Malignant neoplasms of thymus

Cytomegaloviral disease

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Leishmaniasis

Adenocarcinoma of stomach

Other specified malignant neoplasms of kidney, except renal pelvis

Melanoma of skin

Superficial ovarian endometriosis

Malignant neoplasms of oesophagus

Adenocarcinoma of prostate

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Polycystic ovary syndrome

Invasive carcinoma of breast

Glioblastoma of brain

Germ cell tumour of testis

Carpal tunnel syndrome

Malignant neoplasms of adrenal gland

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities