CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Lithospermum Canescens

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TGTTCGAACCTGCATAGCAGAACCACTCGTGAACAAGTTTTTTAACTCGGGCATCGATTAATACGGGATATTCCCGACTATTGATCGGTGCCTAACGGTGCCCCGGCATCTTGCCGTGTGGTGCTTAACAACAACCCCCGGCGTGAGAAGCGCCAAGGAATACTTTAACAATGGCTTGAACCATCCTCTCCCGCTTGCGGGGCGCAGAGGCTTGGAGATGGCTTCTTTCTAAACCACAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGCTAAAGGCACGTCTGCCTGGGCGTCACGCATCACGTCACCCGTCCCCAATTCTCGTGGATGTGGTGGATTGTGACCTCCTGTGCCTTGAGGTGTAGTTGGTCTAAATTCGAGTTCGGAGTTAAGGACTTCACGACAAGTGGTGGTTGGACGACCAACTCGCGTCATGTCGTGTGCCAAACTTTCGTGGCTCTTAAGACCCTAAGGCATGTGCTACCCGACTCTGGGTCGGAAAACTCGTGCTACGACCGCGACCCCAGTCCAGGCGGGATTACCCGCTG

Click for details-----ITS1

Click for details-----ITS2

ATCACGTCACCCGTCCCCAATTCTCGTGGATGTGGTGGATTGTGACCTCCTGTGCCTTGAGGTGTAGTTGGTCTAAATTCGAGTTCGGAGTTAAGGACTTCACGACAAGTGGTGGTTGGACGACCAACTCGCGTCATGTCGTGTGCCAAACTTTCGTGGCTCTTAAGACCCTAAGGCATGTGCTACCCGACTCTGGGTCGGAAAACTCGTGCTACGACCGCGACCCCAGTCCAGGCGGGATTACCCGCTG

Taxonomic Information

Plant ID: NPO12707
Plant Latin Name: Lithospermum Canescens
Taxonomy Genus: Lithospermum
Taxonomy Family: Boraginaceae

Plant External Links:

NCBI TaxonomyDB: 650305
Plant-of-the-World-Online: 117981-1

Used in Medicines

Unknown.

Geographical Distribution

United States

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

38 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

32 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

19 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC83534

Ingredient ID: NPC81470

Ingredient ID: NPC68619

Ingredient ID: NPC67197

Ingredient ID: NPC62657

Ingredient ID: NPC57059

Ingredient ID: NPC43816

Ingredient ID: NPC3898

Ingredient ID: NPC311391

Ingredient ID: NPC299857

Ingredient ID: NPC295664

Ingredient ID: NPC290598

Ingredient ID: NPC289883

Ingredient ID: NPC28952

Ingredient ID: NPC284799

Ingredient ID: NPC272100

Ingredient ID: NPC26605

Ingredient ID: NPC251055

Ingredient ID: NPC247553

Ingredient ID: NPC230301

Ingredient ID: NPC204784

Ingredient ID: NPC200033

Ingredient ID: NPC196188

Ingredient ID: NPC196075

Ingredient ID: NPC192638

Ingredient ID: NPC16651

Ingredient ID: NPC160185

Ingredient ID: NPC155683

Ingredient ID: NPC153094

Ingredient ID: NPC151389

Ingredient ID: NPC149203

Ingredient ID: NPC144054

Ingredient ID: NPC137315

Ingredient ID: NPC134040

Ingredient ID: NPC113733

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC101670

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,CA9,CA12,CA9
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CA9,F2,CA9
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,CA9,F2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	F2,CA9,CES1
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,CA9,F2
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA9,CA12
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA12,CA9
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12,CA9
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	F2,CA9
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CA12,CA9
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA12,CA9
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CA9,F2
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,CA9
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2,CA9
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12,CA9
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,CA9
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,F2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,CA9
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	CA9
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	F2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	F2
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA12
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	CA9
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	CES1
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA9
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CA9
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	F2
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA9
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CA9
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CA9
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Lithospermum Canescens

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

38 All known Ingredients in Total

32 Ingredients with Acceptable Bioavailablity

19 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Hepatocellular carcinoma of liver

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of pancreas

Adenocarcinoma of bronchus or lung

Solid tumour/cancer

Breast cancer

Serous cystadenoma,borderline malignancy of ovary

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Invasive carcinoma of breast

Glioblastoma of brain

Germ cell tumour of testis

Malignant neoplasms of adrenal gland

Coagulation defect

Cardiovascular disease

Angina pectoris

Renal cell carcinoma

Myocardial infarction

Type 2 diabetes mellitus

Asthma

Multiple sclerosis

Bacterial infection

Synthesis disorder

Ischaemic/haemorrhagic stroke

Cerebral ischaemic stroke

Nutritional deficiency

Mature T-cell lymphoma

Coronary thrombosis

Hyper-lipoproteinaemia

Seborrhoeic dermatitis

Chronic arterial occlusive disease

Thrombosis

Peroxisomal disease

Bleeding disorder

Thrombocytopenia

Carcinosarcoma of uterus

Osteoarthritis, unspecified

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Adenocarcinoma of stomach

Tetralogy of Fallot

Urothelial carcinoma of bladder

Chronic rhinosinusitis

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of thymus

Renal cell carcinoma, chromophobe type

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities