• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Trigonella Grandiflora


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATGCCTTACATGCAGTCCAACACGCGAATCAGTTTGAACACATAGGGGTGGGTTGAGGTGTTAACCACCTTGGCCTACCTCAGGTTCGAAGGTGGACGCCTTGTGCGTTCTCCTTTGTGCCAAAAACCAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAATTATGCTCTGAGCGGACCTGCGCGGCATCGGAGACGGTGTTCGTGCGGGTTACGTTTTGACACATTATATATAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACATATCGAAGCCTCTTGCCAATATCCTTTTCATAGGTATTGTGCAATGTGGTGAATGTTGGCCTCCCGTGAGCTGTATTGTCTCACGGTTGGTTGAAAACCGAGACCTTGGTAGGGTGTGCCATGATAGATGGTGGTAGTGTGACCCACGATGCTGTTGAATCATGTGCCTCCCTATTTAACTTGGCCTCTTTTACCCATATGTGTTTTGTAAACGCTCGTG

Click for details-----ITS1

TCGATGCCTTACATGCAGTCCAACACGCGAATCAGTTTGAACACATAGGGGTGGGTTGAGGTGTTAACCACCTTGGCCTACCTCAGGTTCGAAGGTGGACGCCTTGTGCGTTCTCCTTTGTGCCAAAAACCAAACCCCGGCGCTGAATGCGTCAAGGAATTTAAATTATGCTCTGAGCGGACCTGCGCGGCATCGGAGACGGTGTTCGTGCGGGTTACGTTTTGACACATTATATATAGAA

Click for details-----ITS2

ATCGAAGCCTCTTGCCAATATCCTTTTCATAGGTATTGTGCAATGTGGTGAATGTTGGCCTCCCGTGAGCTGTATTGTCTCACGGTTGGTTGAAAACCGAGACCTTGGTAGGGTGTGCCATGATAGATGGTGGTAGTGTGACCCACGATGCTGTTGAATCATGTGCCTCCCTATTTAACTTGGCCTCTTTTACCCATATGTGTTTTGTAAACGCTCGTG
Taxonomic Information

Plant ID: NPO12684
Plant Latin Name: Trigonella Grandiflora
Taxonomy Genus: Trigonella
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 1210110
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

147 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


70 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

52 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9893

Ingredient ID: NPC97444

Ingredient ID: NPC96218

Ingredient ID: NPC95983

Ingredient ID: NPC94967

Ingredient ID: NPC93189

Ingredient ID: NPC90803

Ingredient ID: NPC89422

Ingredient ID: NPC88642

Ingredient ID: NPC86538

Ingredient ID: NPC85813

Ingredient ID: NPC84938

Ingredient ID: NPC81340

Ingredient ID: NPC78263

Ingredient ID: NPC76878

Ingredient ID: NPC76310

Ingredient ID: NPC74765

Ingredient ID: NPC74461

Ingredient ID: NPC73906

Ingredient ID: NPC7172

Ingredient ID: NPC69984

Ingredient ID: NPC67132

Ingredient ID: NPC66577

Ingredient ID: NPC64370

Ingredient ID: NPC64160

Ingredient ID: NPC62498

Ingredient ID: NPC60357

Ingredient ID: NPC55678

Ingredient ID: NPC54152

Ingredient ID: NPC50786

Ingredient ID: NPC49279

Ingredient ID: NPC47566

Ingredient ID: NPC44001

Ingredient ID: NPC42897

Ingredient ID: NPC40839

Ingredient ID: NPC40775

Ingredient ID: NPC37871

Ingredient ID: NPC37541

Ingredient ID: NPC3630

Ingredient ID: NPC33721

Ingredient ID: NPC3357

Ingredient ID: NPC32222

Ingredient ID: NPC31759

Ingredient ID: NPC311094

Ingredient ID: NPC31089

Ingredient ID: NPC309437

Ingredient ID: NPC309237

Ingredient ID: NPC308886

Ingredient ID: NPC307994

Ingredient ID: NPC306544

Ingredient ID: NPC304309

Ingredient ID: NPC303870

Ingredient ID: NPC3025

Ingredient ID: NPC302327

Ingredient ID: NPC299616

Ingredient ID: NPC297643

Ingredient ID: NPC296552

Ingredient ID: NPC293378

Ingredient ID: NPC290753

Ingredient ID: NPC289959

Ingredient ID: NPC286233

Ingredient ID: NPC2833

Ingredient ID: NPC27563

Ingredient ID: NPC273410

Ingredient ID: NPC273385

Ingredient ID: NPC26974

Ingredient ID: NPC265442

Ingredient ID: NPC265033

Ingredient ID: NPC259138

Ingredient ID: NPC258923

Ingredient ID: NPC247385

Ingredient ID: NPC247266

Ingredient ID: NPC243945

Ingredient ID: NPC242712

Ingredient ID: NPC241533

Ingredient ID: NPC239406

Ingredient ID: NPC237781

Ingredient ID: NPC236709

Ingredient ID: NPC236382

Ingredient ID: NPC231377

Ingredient ID: NPC230725

Ingredient ID: NPC224344

Ingredient ID: NPC220860

Ingredient ID: NPC220576

Ingredient ID: NPC218852

Ingredient ID: NPC218525

Ingredient ID: NPC218484

Ingredient ID: NPC216630

Ingredient ID: NPC214217

Ingredient ID: NPC213919

Ingredient ID: NPC205577

Ingredient ID: NPC204121

Ingredient ID: NPC203837

Ingredient ID: NPC202189

Ingredient ID: NPC201404

Ingredient ID: NPC199072

Ingredient ID: NPC198704

Ingredient ID: NPC19868

Ingredient ID: NPC19676

Ingredient ID: NPC196703

Ingredient ID: NPC195221

Ingredient ID: NPC192186

Ingredient ID: NPC190796

Ingredient ID: NPC183220

Ingredient ID: NPC182239

Ingredient ID: NPC179831

Ingredient ID: NPC178552

Ingredient ID: NPC172164

Ingredient ID: NPC167931

Ingredient ID: NPC167400

Ingredient ID: NPC165765

Ingredient ID: NPC163728

Ingredient ID: NPC163062

Ingredient ID: NPC161279

Ingredient ID: NPC161120

Ingredient ID: NPC157422

Ingredient ID: NPC157414

Ingredient ID: NPC156461

Ingredient ID: NPC155182

Ingredient ID: NPC154477

Ingredient ID: NPC150950

Ingredient ID: NPC150329

Ingredient ID: NPC147983

Ingredient ID: NPC145722

Ingredient ID: NPC144682

Ingredient ID: NPC144213

Ingredient ID: NPC14313

Ingredient ID: NPC142850

Ingredient ID: NPC140229

Ingredient ID: NPC139131

Ingredient ID: NPC136014

Ingredient ID: NPC130683

Ingredient ID: NPC125829

Ingredient ID: NPC121022

Ingredient ID: NPC119578

Ingredient ID: NPC116775

Ingredient ID: NPC114874

Ingredient ID: NPC114011

Ingredient ID: NPC11301

Ingredient ID: NPC109813

Ingredient ID: NPC108032

Ingredient ID: NPC107473

Ingredient ID: NPC105246

Ingredient ID: NPC105032

Ingredient ID: NPC104332

Ingredient ID: NPC102253

Ingredient ID: NPC100551