• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Carum Carvi


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CTGCGGAAGGATCATTGTTGAACCCTGCGATAGCAGAACGACCCGCTAACATGTTAAAACATCGGGCAAGCTCATGGGGATTCCTTCCCATGTTGGCGAACCCCAGGTAGGTGGCCGCCCTCGGGTGGCCATCGGCCTACAAAATAATTCGGGCGTGGAATGCGCCAAGGAAATTAAAACTGAATTGATGACCACTTTCCGATAGTCGGGCTGTGGCGTCATTCTAAAACACAAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGTCTGCCTGGGTGTCACGTATCGTGTTGCCCCCAACCACTCACTCCTCTGGGAGCTATTCCGGTTTAGGGGCGGAAATTGGCCTCCCGTACCTTGCGGTGCGGATGGCACAAAAGTGAGTCTCCGATGACGGACGTCGTGACATTGGTGGTTGTTAAAAGAACTTCTTGTCTTGTCACGTGAATCCCCGTCATCTTATGGAGATCTATGATCCTTAAGCGACACACATTGTGTGCGCTCCAA

Click for details-----ITS1

CTGCGGAAGGATCATTGTTGAACCCTGCGATAGCAGAACGACCCGCTAACATGTTAAAACATCGGGCAAGCTCATGGGGATTCCTTCCCATGTTGGCGAACCCCAGGTAGGTGGCCGCCCTCGGGTGGCCATCGGCCTACAAAATAATTCGGGCGTGGAATGCGCCAAGGAAATTAAAACTGAATTGATGACCACTTTCCGATAGTCGGGCTGTGGCGTCATTCTAAAACACAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO12620
Plant Latin Name: Carum Carvi
Taxonomy Genus: Carum
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 48032
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
India; Lebanon; China; Jordan; Thailand; Iraq; Bulgaria

Traditional Medicine System:
Sowa-Rigpa; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Antiseptic; Antispasmodic; Aromatic; Carminative; Digestive; Emmenagogue; Expectorant; Galactogogue; Ophthalmic; Parasiticide; Stimulant

Geographical Distribution

Lebanon; India; Jordan; Thailand; China; Iraq; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

143 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


123 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

75 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC99088

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC92114

Ingredient ID: NPC88566

Ingredient ID: NPC86412

Ingredient ID: NPC85813

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC75369

Ingredient ID: NPC73764

Ingredient ID: NPC72081

Ingredient ID: NPC66052

Ingredient ID: NPC64703

Ingredient ID: NPC62086

Ingredient ID: NPC62045

Ingredient ID: NPC58970

Ingredient ID: NPC58430

Ingredient ID: NPC57333

Ingredient ID: NPC55412

Ingredient ID: NPC50129

Ingredient ID: NPC49151

Ingredient ID: NPC49074

Ingredient ID: NPC490048

Ingredient ID: NPC489907

Ingredient ID: NPC43551

Ingredient ID: NPC43246

Ingredient ID: NPC41865

Ingredient ID: NPC36877

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC3461

Ingredient ID: NPC33415

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC311255

Ingredient ID: NPC310628

Ingredient ID: NPC304979

Ingredient ID: NPC300547

Ingredient ID: NPC299529

Ingredient ID: NPC296337

Ingredient ID: NPC296071

Ingredient ID: NPC295644

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293908

Ingredient ID: NPC287660

Ingredient ID: NPC285783

Ingredient ID: NPC285629

Ingredient ID: NPC281686

Ingredient ID: NPC279865

Ingredient ID: NPC279026

Ingredient ID: NPC276989

Ingredient ID: NPC273322

Ingredient ID: NPC272614

Ingredient ID: NPC269919

Ingredient ID: NPC268862

Ingredient ID: NPC2660

Ingredient ID: NPC264250

Ingredient ID: NPC263757

Ingredient ID: NPC262826

Ingredient ID: NPC253448

Ingredient ID: NPC252587

Ingredient ID: NPC251666

Ingredient ID: NPC248355

Ingredient ID: NPC246165

Ingredient ID: NPC242580

Ingredient ID: NPC241610

Ingredient ID: NPC240206

Ingredient ID: NPC239039

Ingredient ID: NPC237812

Ingredient ID: NPC236705

Ingredient ID: NPC236602

Ingredient ID: NPC232375

Ingredient ID: NPC232247

Ingredient ID: NPC231738

Ingredient ID: NPC231621

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225709

Ingredient ID: NPC224043

Ingredient ID: NPC221580

Ingredient ID: NPC219143

Ingredient ID: NPC213876

Ingredient ID: NPC213749

Ingredient ID: NPC208851

Ingredient ID: NPC208793

Ingredient ID: NPC207642

Ingredient ID: NPC205693

Ingredient ID: NPC204388

Ingredient ID: NPC203468

Ingredient ID: NPC203279

Ingredient ID: NPC202992

Ingredient ID: NPC201844

Ingredient ID: NPC200210

Ingredient ID: NPC19954

Ingredient ID: NPC19241

Ingredient ID: NPC19003

Ingredient ID: NPC189655

Ingredient ID: NPC187770

Ingredient ID: NPC186375

Ingredient ID: NPC185755

Ingredient ID: NPC184267

Ingredient ID: NPC181157

Ingredient ID: NPC180871

Ingredient ID: NPC179987

Ingredient ID: NPC179831

Ingredient ID: NPC17810

Ingredient ID: NPC177112

Ingredient ID: NPC174246

Ingredient ID: NPC168290

Ingredient ID: NPC167400

Ingredient ID: NPC166362

Ingredient ID: NPC164487

Ingredient ID: NPC163984

Ingredient ID: NPC161715

Ingredient ID: NPC158381

Ingredient ID: NPC157364

Ingredient ID: NPC15593

Ingredient ID: NPC152451

Ingredient ID: NPC152384

Ingredient ID: NPC150950

Ingredient ID: NPC148216

Ingredient ID: NPC147983

Ingredient ID: NPC145247

Ingredient ID: NPC141777

Ingredient ID: NPC138113

Ingredient ID: NPC137958

Ingredient ID: NPC136955

Ingredient ID: NPC136014

Ingredient ID: NPC13301

Ingredient ID: NPC130683

Ingredient ID: NPC130209

Ingredient ID: NPC129940

Ingredient ID: NPC126681

Ingredient ID: NPC119949

Ingredient ID: NPC117381

Ingredient ID: NPC116775

Ingredient ID: NPC11433

Ingredient ID: NPC114239

Ingredient ID: NPC112890

Ingredient ID: NPC111690