• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cornus Officinalis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CGAAACCTGCACAGCAGAACGACCCGCGAACGTGTTTTTTACGACGGCGGCGGGGCGCTCTCTGCGGGTGCCCCGGCGTCATCAGGGTGAGCGCGTGCGCGATCCCTTCGCGGGGGGAGGCGGGCGCTTTCCCCTGCAAAAATAACGAACCCCGGCGCGAACCGCGCCAAGGAACACGAACGAAAGAGCGAGCCCGCGAAGCCCCTTCCGCGGGCGCGATCGCGGGCCGGCATCTTCCTTTATCGAAACTGAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGTGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGCGTCTCACATCGCGTCGCCCCCCCCCCCCCCCCCCCCCCCCCTTTGGGGACGGGGGGGGGGGGGCGGACAGTGGCCCCCCGTGCGCTCGCTCACAGCACAGTGTGCGGTCGGCCGAAAAAACGAGTCGCCGGCGACGGACGTCACGACAAGTGGTGGTTGAGACGGAACCTTAAGCGTCCTGTCGTGCGTGCCGCAGTCGCCAGCGCGATGCTCGCGCGACCCTTAACGCGCCGTCACCGACGGTGCCTCCACCGCGACCCCA

Click for details-----ITS1

CGAAACCTGCACAGCAGAACGACCCGCGAACGTGTTTTTTACGACGGCGGCGGGGCGCTCTCTGCGGGTGCCCCGGCGTCATCAGGGTGAGCGCGTGCGCGATCCCTTCGCGGGGGGAGGCGGGCGCTTTCCCCTGCAAAAATAACGAACCCCGGCGCGAACCGCGCCAAGGAACACGAACGAAAGAGCGAGCCCGCGAAGCCCCTTCCGCGGGCGCGATCGCGGGCCGGCATCTTCCTTTATCGAAACTGAA

Click for details-----ITS2

ATCGCGTCGCCCCCCCCACCACCCCACCACACACTTCGGTGACGGTGGGCGGGGGGCGGACAGTGGCCCCCCGTGCGCTCGCTCACAGCACAGTGTGCGGTCGGCCGAAAAAACGAGTCGCCGGCGACGGACGTCACGACAAGTGGTGGTTGAGACGGAACCTTAAGCGTCCTGTCGTGCGTGCCGCAGTCGCCAGCGCGATGCTCGCGCGACCCTTAACGCGCCGTCACCGACGGTGCCTCGACCGCGACCCCA
Taxonomic Information

Plant ID: NPO12588
Plant Latin Name: Cornus Officinalis
Taxonomy Genus: Cornus
Taxonomy Family: Cornaceae

Plant External Links:

NCBI TaxonomyDB: 16906
Plant-of-the-World-Online: 271629-1

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Antibacterial; Antifungal; Antiperiodic; Antiseptic; Antitumor; Astringent; Diuretic; Hepatic; Hypotensive; Tonic

Geographical Distribution

Japan; South Korea; China; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

159 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


69 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

82 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98543

Ingredient ID: NPC97444

Ingredient ID: NPC8816

Ingredient ID: NPC87419

Ingredient ID: NPC85813

Ingredient ID: NPC83032

Ingredient ID: NPC81897

Ingredient ID: NPC81010

Ingredient ID: NPC7343

Ingredient ID: NPC66704

Ingredient ID: NPC65665

Ingredient ID: NPC62840

Ingredient ID: NPC62806

Ingredient ID: NPC61638

Ingredient ID: NPC59712

Ingredient ID: NPC51700

Ingredient ID: NPC51173

Ingredient ID: NPC49771

Ingredient ID: NPC4899

Ingredient ID: NPC488472

Ingredient ID: NPC488471

Ingredient ID: NPC488470

Ingredient ID: NPC488469

Ingredient ID: NPC488468

Ingredient ID: NPC488467

Ingredient ID: NPC488466

Ingredient ID: NPC488465

Ingredient ID: NPC488464

Ingredient ID: NPC488463

Ingredient ID: NPC488462

Ingredient ID: NPC488461

Ingredient ID: NPC488460

Ingredient ID: NPC488459

Ingredient ID: NPC488458

Ingredient ID: NPC488457

Ingredient ID: NPC488456

Ingredient ID: NPC47363

Ingredient ID: NPC46641

Ingredient ID: NPC43696

Ingredient ID: NPC41201

Ingredient ID: NPC39927

Ingredient ID: NPC39426

Ingredient ID: NPC37859

Ingredient ID: NPC35185

Ingredient ID: NPC3357

Ingredient ID: NPC32977

Ingredient ID: NPC328670

Ingredient ID: NPC325325

Ingredient ID: NPC323472

Ingredient ID: NPC322271

Ingredient ID: NPC321664

Ingredient ID: NPC315603

Ingredient ID: NPC31357

Ingredient ID: NPC312996

Ingredient ID: NPC311988

Ingredient ID: NPC31137

Ingredient ID: NPC307961

Ingredient ID: NPC307699

Ingredient ID: NPC306344

Ingredient ID: NPC299484

Ingredient ID: NPC299059

Ingredient ID: NPC298224

Ingredient ID: NPC294902

Ingredient ID: NPC293696

Ingredient ID: NPC292792

Ingredient ID: NPC290437

Ingredient ID: NPC289437

Ingredient ID: NPC288537

Ingredient ID: NPC287986

Ingredient ID: NPC287539

Ingredient ID: NPC282895

Ingredient ID: NPC282847

Ingredient ID: NPC282120

Ingredient ID: NPC281131

Ingredient ID: NPC276863

Ingredient ID: NPC270908

Ingredient ID: NPC269625

Ingredient ID: NPC269540

Ingredient ID: NPC2665

Ingredient ID: NPC26639

Ingredient ID: NPC264711

Ingredient ID: NPC26383

Ingredient ID: NPC26329

Ingredient ID: NPC257424

Ingredient ID: NPC257124

Ingredient ID: NPC256186

Ingredient ID: NPC255677

Ingredient ID: NPC255662

Ingredient ID: NPC252433

Ingredient ID: NPC24751

Ingredient ID: NPC242203

Ingredient ID: NPC24071

Ingredient ID: NPC235260

Ingredient ID: NPC232954

Ingredient ID: NPC232914

Ingredient ID: NPC231710

Ingredient ID: NPC225710

Ingredient ID: NPC224246

Ingredient ID: NPC223982

Ingredient ID: NPC221546

Ingredient ID: NPC22149

Ingredient ID: NPC221090

Ingredient ID: NPC217226

Ingredient ID: NPC216826

Ingredient ID: NPC216630

Ingredient ID: NPC213236

Ingredient ID: NPC211489

Ingredient ID: NPC21136

Ingredient ID: NPC20791

Ingredient ID: NPC207326

Ingredient ID: NPC205579

Ingredient ID: NPC204120

Ingredient ID: NPC203662

Ingredient ID: NPC202045

Ingredient ID: NPC195019

Ingredient ID: NPC192709

Ingredient ID: NPC192402

Ingredient ID: NPC19044

Ingredient ID: NPC186653

Ingredient ID: NPC179950

Ingredient ID: NPC177013

Ingredient ID: NPC170960

Ingredient ID: NPC170204

Ingredient ID: NPC16656

Ingredient ID: NPC162656

Ingredient ID: NPC15924

Ingredient ID: NPC156654

Ingredient ID: NPC154172

Ingredient ID: NPC150147

Ingredient ID: NPC14930

Ingredient ID: NPC145038

Ingredient ID: NPC142415

Ingredient ID: NPC135836

Ingredient ID: NPC131269

Ingredient ID: NPC131166

Ingredient ID: NPC125445

Ingredient ID: NPC124530

Ingredient ID: NPC122078

Ingredient ID: NPC120021

Ingredient ID: NPC119949

Ingredient ID: NPC119631

Ingredient ID: NPC116794

Ingredient ID: NPC11592

Ingredient ID: NPC115295

Ingredient ID: NPC11204

Ingredient ID: NPC111592

Ingredient ID: NPC109782

Ingredient ID: NPC109169

Ingredient ID: NPC10908

Ingredient ID: NPC108455

Ingredient ID: NPC108218

Ingredient ID: NPC1075

Ingredient ID: NPC107482

Ingredient ID: NPC106668

Ingredient ID: NPC104222

Ingredient ID: NPC102123

Ingredient ID: NPC101051

Ingredient ID: NPC100749

Ingredient ID: NPC100742