CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Sauromatum Giganteum

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGTATCCTACCACTCGACGCACTCGCGAACAGTTGACCCTGCCACCCCGGAGGGGGCCAGGGGTGCGGCTCTGGACGTCCGGATGTTCGTCCTCCCCGCTGTCCCGTCCCTCTTCGGGATATTTTTCCCCGCCTCCGACACGCCCGACCGGTGGGAGCCTCCCGTCGATCGGACCGTCGGCCGGCGGGATGACGAACCTTCTCGGCGCGGTATGCGCCAAGGAAAACGGAAGTGAAGGCCCGCGTCATCCACCCGTGCGGCGGACGCACGCGGCGCTCATCACCGATACGAAACGAGTCTGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACCCCACATCGCTCCCCGACCCCCACCCCCCCTTACAAGGGGACACAMGCGTGTGGGACGAGAGATGCGGAGATTGGCCCACCGTGCACCAGCGCGGCGGGYTGAAGAACTCGGCCCTCCCGCCGGGCGACTAACGGCGAGTGGTGGACGACGCTCATCGTCGCCGTGGCGCACGCCCGCGCACAAGGATGGACCGACCATAAGGAACCCAGTCATCGGAGAGAACGGCCGTATCTAAGATAAGGTCGCTCTTCGACCGCGACCCCAG

Click for details-----ITS1

Click for details-----ITS2

CCCACATCGCTCCCCGACCCCCACCCCCCCTTACAAGGGGACACAMGCGTGTGGGACGAGAGATGCGGAGATTGGCCCACCGTGCACCAGCGCGGCGGGYTGAAGAACTCGGCCCTCCCGCCGGGCGACTAACGGCGAGTGGTGGACGACGCTCATCGTCGCCGTGGCGCACGCCCGCGCACAAGGATGGACCGACCATAAGGAACCCAGTCATCGGAGAGAACGGCCGTATCTAAGATAAGGTCGCTCTTCGACCGCGACCCCAG

Taxonomic Information

Plant ID: NPO12583
Plant Latin Name: Sauromatum Giganteum
Taxonomy Genus: Sauromatum
Taxonomy Family: Araceae

Plant External Links:

NCBI TaxonomyDB: 227256
Plant-of-the-World-Online: 77104738-1

Used in Medicines

Unknown.

Geographical Distribution

China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

56 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

41 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

26 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC91443

Ingredient ID: NPC88417

Ingredient ID: NPC8776

Ingredient ID: NPC81468

Ingredient ID: NPC70744

Ingredient ID: NPC64434

Ingredient ID: NPC60853

Ingredient ID: NPC57521

Ingredient ID: NPC56487

Ingredient ID: NPC51709

Ingredient ID: NPC486422

Ingredient ID: NPC486421

Ingredient ID: NPC486420

Ingredient ID: NPC486419

Ingredient ID: NPC486418

Ingredient ID: NPC45828

Ingredient ID: NPC38384

Ingredient ID: NPC307298

Ingredient ID: NPC304309

Ingredient ID: NPC302124

Ingredient ID: NPC297550

Ingredient ID: NPC297079

Ingredient ID: NPC294902

Ingredient ID: NPC290975

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC273493

Ingredient ID: NPC27252

Ingredient ID: NPC268888

Ingredient ID: NPC263545

Ingredient ID: NPC246563

Ingredient ID: NPC230301

Ingredient ID: NPC228385

Ingredient ID: NPC225515

Ingredient ID: NPC220930

Ingredient ID: NPC2194

Ingredient ID: NPC216630

Ingredient ID: NPC20819

Ingredient ID: NPC206800

Ingredient ID: NPC19365

Ingredient ID: NPC186840

Ingredient ID: NPC184064

Ingredient ID: NPC178636

Ingredient ID: NPC177453

Ingredient ID: NPC174213

Ingredient ID: NPC171280

Ingredient ID: NPC162742

Ingredient ID: NPC144916

Ingredient ID: NPC135010

Ingredient ID: NPC120369

Ingredient ID: NPC118583

Ingredient ID: NPC115448

Ingredient ID: NPC111567

Ingredient ID: NPC1075

Ingredient ID: NPC104052

Ingredient ID: NPC103383

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	AKR1C3	Aldo-keto-reductase family 1 member C3	P42330	CHEMBL4681
Therapeutic Target	Fatty acid binding protein family	FABP4	Fatty acid binding protein adipocyte	P15090	CHEMBL2083
Therapeutic Target	Metallo protease	MMP1	Matrix metalloproteinase-1	P03956	CHEMBL332
Therapeutic Target	Metallo protease	MMP9	Matrix metalloproteinase 9	P14780	CHEMBL321
Therapeutic Target	Metallo protease	MMP2	Matrix metalloproteinase-2	P08253	CHEMBL333
Therapeutic Target	Oxidoreductase	HSD17B10	Endoplasmic reticulum-associated amyloid beta-peptide-binding protein	Q99714	CHEMBL4159
Therapeutic Target	Oxidoreductase	ALOX15	Arachidonate 15-lipoxygenase	P16050	CHEMBL2903
Therapeutic Target	Peptide receptor (family A GPCR)	TSHR	Thyroid stimulating hormone receptor	P16473	CHEMBL1963
Therapeutic Target	Small molecule receptor (family A GPCR)	FFAR4	G-protein coupled receptor 120	Q5NUL3	CHEMBL5339
Therapeutic Target	Small molecule receptor (family A GPCR)	FFAR1	Free fatty acid receptor 1	O14842	CHEMBL4422
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	NFKB1	Nuclear factor NF-kappa-B p105 subunit	P19838	CHEMBL3251
Therapeutic Target	Unclassified protein	SNCA	Alpha-synuclein	P37840	CHEMBL6152

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	8

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT02063802	Metformin vs Conjugated Linoleic Acid and an Intervention Program With Healthy Habits in Obese Children	obesity	Linoleic Acid (NPC85813)	NP level
NCT00951158	A Molecular Pharmacodynamic Dose-titration Trial of Conjugated Linoleic Acid (CLA; Clarinol®) in Patients With Advanced Solid Tumors	neoplasm	Linoleic Acid (NPC85813)	NP level
NCT00607945	Dietary Fatty Acids as Complementary Therapy in Type 2 Diabetes Mellitus	type 2 diabetes mellitus	Linoleic Acid (NPC85813)	NP level
NCT00908791	Proof of Principle Trial to Determine if Nutritional Supplement Conjugated Linoleic Acid (CLA) Can Modulate the Lipogenic Pathway in Breast Cancer Tissue	breast cancer	Linoleic Acid (NPC85813)	NP level
NCT04648917	GASC1 Inhibitor Caffeic Acid for Squamous Esophageal Cell Cancer (ESCC)	esophageal cancer	Caffeic Acid (NPC294902)	NP level
NCT00204932	Effects of CLA Supplements on Body Weight and Fat Oxidation	obesity	Linoleic Acid (NPC85813)	NP level
NCT00029679	Borage Oil and Ginkgo Biloba (EGb 761) in Asthma	asthma	Linoleic Acid (NPC85813)	NP level
NCT02351622	Caffeic Acid Tablets as a Second-line Therapy for ITP	autoimmune thrombocytopenic purpura	Caffeic Acid (NPC294902)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	MMP9,FFAR1,HSD17B10,FABP5,MMP1,TSHR,TDP1,FFAR4,ALOX15
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	MMP9,FFAR1,OR51E2,SNCA,MMP1,TDP1,FFAR4,LMNA,ALOX15
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AKR1C3,MMP9,OR51E2,FABP4,MMP1,FABP5,AKR1C3,MMP1,MMP9
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	MMP9,FABP3,MMP1,FABP5,TSHR,TDP1,FFAR4,ALOX15
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	MMP9,FABP3,OR51E2,FABP4,MMP1,FABP5,MMP2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	MMP9,FFAR1,FABP3,OR51E2,SNCA,MMP1,FABP5
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	MMP9,OR51E2,FABP5,MMP1,MMP2,LMNA
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	AKR1C3,MMP9,OR51E2,MMP1,TSHR,F2
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	MMP9,HSD17B10,NFKB1,FABP5,FFAR4,ALOX15
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	FABP3,SNCA,MMP1,FABP5,F2,MMP2
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	MMP9,OR51E2,SNCA,MMP1,FABP5
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	AKR1C3,MMP9,FABP4,MMP1,F2
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	AKR1C3,MMP9,MMP1,TSHR,F2
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	FFAR1,NFKB1,F2 NCT00607945
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	MMP9,MMP1,TSHR,MMP2
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	MMP9,MMP1,F2,ALOX15
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	MMP9,MMP1,F2,ALOX15
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	MMP2,MMP9,MMP1
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	MMP2,MMP9,MMP1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	MMP1,NFKB1,MMP9
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	MMP9 MMP9,MMP1
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AKR1C3,MMP9,MMP1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	FABP3,SNCA,LMNA
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	MMP9,MMP1,ALOX15
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	MMP9,KDM4E,ALOX15
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	FABP5,ALOX15,OR51E2
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	FFAR1,LMNA,MMP2
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	FABP5,TSHR,LMNA
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	FFAR4,MMP2,OR51E2
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	NFKB1,MMP9
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NFKB1,F2
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	MMP1,MMP2
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	MMP9,F2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2 NCT00029679
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	MMP2,MMP9
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	NFKB1 FABP5
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	NCT00204932,NCT02063802
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	MMP9,MMP1
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	MMP9,MMP2
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	MMP9,FABP4
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	MMP1,F2
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	FABP3,FFAR1
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	MMP9,MMP1
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	FABP4,MMP1
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	MMP9,MMP1
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	MMP9,FFAR1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	FFAR1,MMP1
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	MMP9,MMP1
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1C3,MMP9
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	FFAR1,HSD17B10,FABP3,OR51E2,FABP4,MMP1,FABP5,TSHR,MMP2,TDP1,LMNA
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	MMP9,FABP5,FFAR4,MMP9,OR51E2,FABP5,MMP1,TSHR,F2,FFAR4
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	AKR1C3,FABP3,OR51E2,SNCA,MMP1,F2,MMP2,FFAR4,LMNA,ALOX15
Autonomic nervous system disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D87	SNCA
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	AKR1C3
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	NFKB1
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	NFKB1
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	NFKB1
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	SNCA
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	F2
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AKR1C3
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	FFAR1
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	NFKB1
Hepatic fibrosis/cirrhosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB93	MMP2
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	TSHR
Ulcerative colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD71	MMP9
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	NFKB1
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	MMP2
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	SNCA
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Hypo-thyroidism Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A00	TSHR
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	NFKB1
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	NFKB1
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	MMP9
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	NFKB1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	FFAR1
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	TNKS
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	NFKB1
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	NFKB1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	NCT00908791
Immune thrombocytopenic purpura Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64.10	NCT02351622
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	NCT04648917
Neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 02	NCT00951158
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	TSHR
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	TSHR
Malignant neoplasms of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	FABP4
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	NFKB1
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F2
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	MMP9
Malignant neoplasms of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	FABP4
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	FFAR4
Malaria, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F4Z	MMP9
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	FFAR1
Malignant neoplasm of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	FABP4
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MMP9

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Sauromatum Giganteum

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

56 All known Ingredients in Total

41 Ingredients with Acceptable Bioavailablity

26 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Carcinosarcoma of uterus

Mesothelioma of pleura

Hepatocellular carcinoma of liver

Serous cystadenoma,borderline malignancy of ovary

Hepatoblastoma

Malignant neoplasms of adrenal gland

Malignant neoplasms of biliary tract, distal bile duct

Squamous cell carcinoma of bronchus or lung

Malignant neoplasms of thymus

Germ cell tumour of testis

Pheochromocytoma

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Adenocarcinoma of bronchus or lung

Type 2 diabetes mellitus

Leishmaniasis

Adenocarcinoma of stomach

Malignant neoplasms of corpus uteri, unspecified

Lung cancer

Brain cancer

Rheumatoid arthritis

Crohn disease

Other specified malignant neoplasms of bronchus or lung

Superficial ovarian endometriosis

Malignant neoplasms of oesophagus

Cytomegaloviral disease

Adenocarcinoma of prostate

Chikungunya virus disease

Glioblastoma of brain

Carpal tunnel syndrome

Solid tumour/cancer

Multiple sclerosis

Pancreatic cancer

Ischaemic/haemorrhagic stroke

Asthma

Renal cell carcinoma

Psoriasis

Obesity

Inflammatory bowel diseases, unspecified

Osteoarthritis, unspecified

Non-alcoholic fatty liver disease

Other specified malignant neoplasms ofcolon

Melanoma of skin

Urothelial carcinoma of bladder

Systemic sclerosis

Chronic rhinosinusitis

Systemic lupus erythematosus

Malignant neoplasms of thyroid gland, unspecified

Invasive carcinoma of breast

Gliomas of brain

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Adenocarcinoma of pancreas

Autonomic nervous system disorder

Female pelvic pain

Thrombocytopenia

Acute myeloid leukaemia

Fungal infection

Bleeding disorder

Coagulation defect

Myocardial infarction

Skin and skin-structure infection

Parkinsonism

Thrombosis

Cerebral ischaemic stroke