• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Camptotheca Acuminata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGTCGAAACCTGCCTAGCAGAACGACCCGCGAACGAGTTAAATCAACCGTACGGGGGCCCAGGCCCCCCTCCCCGGTCGAAGGGGCGCGCGTCCTCGCGTGCTTCCCGGCCGGACGATGAACCCCGGCGCGATTTGCGCCAAGGAACTCACAACAAAAGCTCGGGCTGCTGTCTCCCCGGCTCCCGGGAGAGCGGTTGTCCTCGGTGCCTTTAGCAAAGAGAAAAATTAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCAAACCCCGCTCCCGGCATCGGGGCGTGGCTGCTTTGGGGGCGGATATTGGCCTCCCGTGGGCGACATAGAGAACGCGGCTGGCCGAAACAAGAGTCCCCCCGAAGTGGCGGGCGTCACGACAAGTGGTGGTTGAACGGCCCCTGGCCACGGAATTGTCCTGTCGTGCGTACGTCCATCCGGCGGAGAGCTCCCGGCGACCCTCACGTGCCGTCCCCGACGGCGCTCCGACCGCGACCCCA

Click for details-----ITS1

TTGTCGAAACCTGCCTAGCAGAACGACCCGCGAACGAGTTAAATCAACCGTACGGGGGCCCAGGCCCCCCTCCCCGGTCGAAGGGGCGCGCGTCCTCGCGTGCTTCCCGGCCGGACGATGAACCCCGGCGCGATTTGCGCCAAGGAACTCACAACAAAAGCTCGGGCTGCTGTCTCCCCGGCTCCCGGGAGAGCGGTTGTCCTCGGTGCCTTTAGCAAAGAGAAAAATTAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCAAACCCCGCTCCCGGCATCGGGGCGTGGCTGCTTTGGGGGCGGATATTGGCCTCCCGTGGGCGACATAGAGAACGCGGCTGGCCGAAACAAGAGTCCCCCCGAAGTGGCGGGCGTCACGACAAGTGGTGGTTGAACGGCCCCTGGCCACGGAATTGTCCTGTCGTGCGTACGTCCATCCGGCGGAGAGCTCCCGGCGACCCTCACGTGCCGTCCCCGACGGCGCTCCGACCGCGACCCCA
Taxonomic Information

Plant ID: NPO12582
Plant Latin Name: Camptotheca Acuminata
Taxonomy Genus: Camptotheca
Taxonomy Family: Nyssaceae

Plant External Links:

NCBI TaxonomyDB: 16922
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

73 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


57 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

29 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9794

Ingredient ID: NPC97553

Ingredient ID: NPC97117

Ingredient ID: NPC96146

Ingredient ID: NPC90909

Ingredient ID: NPC90860

Ingredient ID: NPC88759

Ingredient ID: NPC82505

Ingredient ID: NPC78500

Ingredient ID: NPC74562

Ingredient ID: NPC71918

Ingredient ID: NPC64370

Ingredient ID: NPC61435

Ingredient ID: NPC470003

Ingredient ID: NPC42856

Ingredient ID: NPC37502

Ingredient ID: NPC320240

Ingredient ID: NPC317111

Ingredient ID: NPC31662

Ingredient ID: NPC316181

Ingredient ID: NPC311858

Ingredient ID: NPC303320

Ingredient ID: NPC301585

Ingredient ID: NPC299480

Ingredient ID: NPC297070

Ingredient ID: NPC290988

Ingredient ID: NPC28848

Ingredient ID: NPC284383

Ingredient ID: NPC280417

Ingredient ID: NPC279028

Ingredient ID: NPC275552

Ingredient ID: NPC275463

Ingredient ID: NPC267229

Ingredient ID: NPC264317

Ingredient ID: NPC261080

Ingredient ID: NPC250069

Ingredient ID: NPC239406

Ingredient ID: NPC231717

Ingredient ID: NPC221897

Ingredient ID: NPC220919

Ingredient ID: NPC214584

Ingredient ID: NPC208936

Ingredient ID: NPC20791

Ingredient ID: NPC201362

Ingredient ID: NPC197396

Ingredient ID: NPC195265

Ingredient ID: NPC194055

Ingredient ID: NPC187421

Ingredient ID: NPC181398

Ingredient ID: NPC17168

Ingredient ID: NPC169318

Ingredient ID: NPC168070

Ingredient ID: NPC164115

Ingredient ID: NPC160772

Ingredient ID: NPC154477

Ingredient ID: NPC151781

Ingredient ID: NPC151046

Ingredient ID: NPC1507

Ingredient ID: NPC150050

Ingredient ID: NPC144682

Ingredient ID: NPC14325

Ingredient ID: NPC139114

Ingredient ID: NPC138421

Ingredient ID: NPC129909

Ingredient ID: NPC1294

Ingredient ID: NPC128115

Ingredient ID: NPC127122

Ingredient ID: NPC126365

Ingredient ID: NPC110942

Ingredient ID: NPC108218

Ingredient ID: NPC106338

Ingredient ID: NPC100773

Ingredient ID: NPC100471