• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Phalaris Canariensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTGACCCTGACCAAAACAGACCGTGCACGCGTCCTCTATCTAGCCGAGCGGCGGAAACTTCTGTCGCCTGGCCAAGTCCTCGACACCTCATCTCCTCGGAGTTGGGGCTCGGGGTAAAAGAACCTACGGCGCCTAAGGCGTCAAGGAACACTGTGCCTAGCACGGGGGACGCGGACGGCTTGCTGTCCGCCTCCTCGTGCTGCAATGCTTTATAATCAACATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACCTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATTCGGCTAAGGGCACGCCTGCCTGGGCGTCACGCTTAACACGCTCCCAAATCCACTACTCGGGGATTGGGATGCGGCATGTGGCTTCCCGTCACGCAAGTGGCGGTGGGCCGAAGATATGGCTGCTGGTGTATCGTGCCGGACACAGCGAGTGGTGAGCATCCTTGCTTTACTTACCGCAGTGCATTCGGTGCGTAGCCGACATGATGGCCTAGAAGGACCCTATAACGGAGCGCATGACGCTGGACCGCGACCCCAG

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO12516
Plant Latin Name: Phalaris Canariensis
Taxonomy Genus: Phalaris
Taxonomy Family: Poaceae

Plant External Links:

NCBI TaxonomyDB: 376798
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
India

Traditional Medicine System:
Indian Folk

Geographical Distribution

India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

119 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


72 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

29 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98213

Ingredient ID: NPC94017

Ingredient ID: NPC92970

Ingredient ID: NPC91433

Ingredient ID: NPC88550

Ingredient ID: NPC83744

Ingredient ID: NPC83409

Ingredient ID: NPC80578

Ingredient ID: NPC79294

Ingredient ID: NPC78263

Ingredient ID: NPC77672

Ingredient ID: NPC75989

Ingredient ID: NPC74210

Ingredient ID: NPC73144

Ingredient ID: NPC62765

Ingredient ID: NPC60643

Ingredient ID: NPC55778

Ingredient ID: NPC55678

Ingredient ID: NPC54815

Ingredient ID: NPC53887

Ingredient ID: NPC53802

Ingredient ID: NPC51966

Ingredient ID: NPC50898

Ingredient ID: NPC46631

Ingredient ID: NPC45188

Ingredient ID: NPC44062

Ingredient ID: NPC37556

Ingredient ID: NPC36875

Ingredient ID: NPC35103

Ingredient ID: NPC31499

Ingredient ID: NPC310291

Ingredient ID: NPC306048

Ingredient ID: NPC304871

Ingredient ID: NPC299822

Ingredient ID: NPC297344

Ingredient ID: NPC294726

Ingredient ID: NPC279809

Ingredient ID: NPC279098

Ingredient ID: NPC278744

Ingredient ID: NPC276223

Ingredient ID: NPC275826

Ingredient ID: NPC2738

Ingredient ID: NPC270239

Ingredient ID: NPC269079

Ingredient ID: NPC26884

Ingredient ID: NPC26867

Ingredient ID: NPC260268

Ingredient ID: NPC258737

Ingredient ID: NPC257767

Ingredient ID: NPC254171

Ingredient ID: NPC254057

Ingredient ID: NPC253377

Ingredient ID: NPC24971

Ingredient ID: NPC249244

Ingredient ID: NPC248293

Ingredient ID: NPC238437

Ingredient ID: NPC236709

Ingredient ID: NPC236626

Ingredient ID: NPC233266

Ingredient ID: NPC231707

Ingredient ID: NPC228781

Ingredient ID: NPC22531

Ingredient ID: NPC224651

Ingredient ID: NPC21777

Ingredient ID: NPC213066

Ingredient ID: NPC20791

Ingredient ID: NPC207254

Ingredient ID: NPC205868

Ingredient ID: NPC203882

Ingredient ID: NPC200639

Ingredient ID: NPC199132

Ingredient ID: NPC194633

Ingredient ID: NPC19240

Ingredient ID: NPC19211

Ingredient ID: NPC190729

Ingredient ID: NPC187006

Ingredient ID: NPC179950

Ingredient ID: NPC174089

Ingredient ID: NPC171363

Ingredient ID: NPC171137

Ingredient ID: NPC170197

Ingredient ID: NPC163757

Ingredient ID: NPC162501

Ingredient ID: NPC161083

Ingredient ID: NPC159323

Ingredient ID: NPC159259

Ingredient ID: NPC156393

Ingredient ID: NPC153696

Ingredient ID: NPC152695

Ingredient ID: NPC151364

Ingredient ID: NPC150531

Ingredient ID: NPC149433

Ingredient ID: NPC149203

Ingredient ID: NPC148739

Ingredient ID: NPC143379

Ingredient ID: NPC142146

Ingredient ID: NPC136717

Ingredient ID: NPC133671

Ingredient ID: NPC133638

Ingredient ID: NPC131076

Ingredient ID: NPC127635

Ingredient ID: NPC127446

Ingredient ID: NPC126200

Ingredient ID: NPC125675

Ingredient ID: NPC125641

Ingredient ID: NPC124834

Ingredient ID: NPC124752

Ingredient ID: NPC124437

Ingredient ID: NPC123210

Ingredient ID: NPC120217

Ingredient ID: NPC11927

Ingredient ID: NPC118369

Ingredient ID: NPC116775

Ingredient ID: NPC11523

Ingredient ID: NPC112903

Ingredient ID: NPC110530

Ingredient ID: NPC107845

Ingredient ID: NPC104287

Ingredient ID: NPC10134