• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Asarum Heterotropoides


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATRCCTATCAATCAGATTGACCACGCGAACTTGTGATGCCCAACTATCGGGGGCGGCGTTCAGCCAACCCCGTCCCTTTGCACCGCGGGATGTCCRTGTCTCAAGCCTTGAGCAATCAGGTTTGTTGACGGTACGTTCGGCGGCTGACTCAGGGAGGCCGAACAACAACTCGGCGCGGTCAGCGCCAAGGATTTGGAATTACGTGTATGCCATTCTCATCCGTGGGTTTGTCAYTACATCAATCTAAAAAATCACGACTCTCGGCAACGGATATCTTGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCTTTAGGTTGAGGGCACACCTGCTTGGGCGTCATGCTATGCGTCGCTCCCACATCCGTCTCGGATATAGGACGCGGAKATTGGCTATCCGTTCAAATCATTGCGCGGTTTGCCTAAAATTTGGACCTTTGGCGGRCTGCGATACGTCTAGTGGTGGTTGTTGGCTCATTRTTAGCYGCGATTGACAGAAGGACGCGTCGATGCCCCGCCTTAAGGTTTGCCTTTGGAACCCAAGTCGGGGGTCTTTTGACTTYCGAA

Click for details-----ITS1

TCGATRCCTATCAATCAGATTGACCACGCGAACTTGTGATGCCCAACTATCGGGGGCGGCGTTCAGCCAACCCCGTCCCTTTGCACCGCGGGATGTCCRTGTCTCAAGCCTTGAGCAATCAGGTTTGTTGACGGTACGTTCGGCGGCTGACTCAGGGAGGCCGAACAACAACTCGGCGCGGTCAGCGCCAAGGATTTGGAATTACGTGTATGCCATTCTCATCCGTGGGTTTGTCAYTACATCAATCTAAAAAATCA

Click for details-----ITS2

TATGCGTCGCTCCCACATCCGTCTCGGATATAGGACGCGGAKATTGGCTATCCGTTCAAATCATTGCGCGGTTTGCCTAAAATTTGGACCTTTGGCGGRCTGCGATACGTCTAGTGGTGGTTGTTGGCTCATTRTTAGCYGCGATTGACAGAAGGACGCGTCGATGCCCCGCCTTAAGGTTTGCCTTTGGAACCCAAGTCGGGGGTCTTTTGACTTYCGAA
Taxonomic Information

Plant ID: NPO12468
Plant Latin Name: Asarum Heterotropoides
Taxonomy Genus: Asarum
Taxonomy Family: Aristolochiaceae

Plant External Links:

NCBI TaxonomyDB: 366663
Plant-of-the-World-Online: n.a.

Used in Medicines

Unknown.

Geographical Distribution
Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

161 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


148 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

93 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC97870

Ingredient ID: NPC97128

Ingredient ID: NPC96630

Ingredient ID: NPC92869

Ingredient ID: NPC90105

Ingredient ID: NPC89422

Ingredient ID: NPC89069

Ingredient ID: NPC88640

Ingredient ID: NPC88566

Ingredient ID: NPC87682

Ingredient ID: NPC85665

Ingredient ID: NPC85661

Ingredient ID: NPC84856

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC74295

Ingredient ID: NPC73964

Ingredient ID: NPC7343

Ingredient ID: NPC71853

Ingredient ID: NPC71703

Ingredient ID: NPC71645

Ingredient ID: NPC71506

Ingredient ID: NPC69213

Ingredient ID: NPC67790

Ingredient ID: NPC64370

Ingredient ID: NPC64176

Ingredient ID: NPC57471

Ingredient ID: NPC56271

Ingredient ID: NPC54264

Ingredient ID: NPC52464

Ingredient ID: NPC51700

Ingredient ID: NPC50629

Ingredient ID: NPC46679

Ingredient ID: NPC46330

Ingredient ID: NPC46114

Ingredient ID: NPC45727

Ingredient ID: NPC44751

Ingredient ID: NPC44671

Ingredient ID: NPC43143

Ingredient ID: NPC40249

Ingredient ID: NPC37871

Ingredient ID: NPC37802

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC33664

Ingredient ID: NPC33611

Ingredient ID: NPC32441

Ingredient ID: NPC31279

Ingredient ID: NPC308218

Ingredient ID: NPC307123

Ingredient ID: NPC29883

Ingredient ID: NPC296742

Ingredient ID: NPC296337

Ingredient ID: NPC293343

Ingredient ID: NPC292869

Ingredient ID: NPC292792

Ingredient ID: NPC287731

Ingredient ID: NPC287660

Ingredient ID: NPC287331

Ingredient ID: NPC287191

Ingredient ID: NPC286683

Ingredient ID: NPC284731

Ingredient ID: NPC283823

Ingredient ID: NPC283655

Ingredient ID: NPC281131

Ingredient ID: NPC280958

Ingredient ID: NPC271397

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC268647

Ingredient ID: NPC262789

Ingredient ID: NPC259512

Ingredient ID: NPC258672

Ingredient ID: NPC248372

Ingredient ID: NPC247922

Ingredient ID: NPC247786

Ingredient ID: NPC247018

Ingredient ID: NPC246620

Ingredient ID: NPC246165

Ingredient ID: NPC244513

Ingredient ID: NPC24327

Ingredient ID: NPC24294

Ingredient ID: NPC240702

Ingredient ID: NPC240684

Ingredient ID: NPC239039

Ingredient ID: NPC232375

Ingredient ID: NPC227670

Ingredient ID: NPC227458

Ingredient ID: NPC22229

Ingredient ID: NPC222001

Ingredient ID: NPC221733

Ingredient ID: NPC218879

Ingredient ID: NPC217191

Ingredient ID: NPC217002

Ingredient ID: NPC216900

Ingredient ID: NPC215756

Ingredient ID: NPC215632

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC208151

Ingredient ID: NPC20791

Ingredient ID: NPC207643

Ingredient ID: NPC207561

Ingredient ID: NPC204120

Ingredient ID: NPC203424

Ingredient ID: NPC200903

Ingredient ID: NPC196490

Ingredient ID: NPC193666

Ingredient ID: NPC19319

Ingredient ID: NPC190945

Ingredient ID: NPC190810

Ingredient ID: NPC189036

Ingredient ID: NPC188238

Ingredient ID: NPC187796

Ingredient ID: NPC186903

Ingredient ID: NPC186098

Ingredient ID: NPC180684

Ingredient ID: NPC180466

Ingredient ID: NPC179950

Ingredient ID: NPC178223

Ingredient ID: NPC177112

Ingredient ID: NPC173996

Ingredient ID: NPC171928

Ingredient ID: NPC168855

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC165386

Ingredient ID: NPC164542

Ingredient ID: NPC161557

Ingredient ID: NPC158526

Ingredient ID: NPC157298

Ingredient ID: NPC156139

Ingredient ID: NPC152989

Ingredient ID: NPC152618

Ingredient ID: NPC150892

Ingredient ID: NPC150329

Ingredient ID: NPC149412

Ingredient ID: NPC14682

Ingredient ID: NPC141777

Ingredient ID: NPC141699

Ingredient ID: NPC13991

Ingredient ID: NPC138113

Ingredient ID: NPC136232

Ingredient ID: NPC131981

Ingredient ID: NPC130398

Ingredient ID: NPC129687

Ingredient ID: NPC128027

Ingredient ID: NPC127326

Ingredient ID: NPC123526

Ingredient ID: NPC119949

Ingredient ID: NPC119579

Ingredient ID: NPC118284

Ingredient ID: NPC115499

Ingredient ID: NPC114239

Ingredient ID: NPC113101

Ingredient ID: NPC111544

Ingredient ID: NPC105509

Ingredient ID: NPC101153

Ingredient ID: NPC100223