• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Quercus Mongolica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAATTGGTTACAACCGACGGGGGGTGGAGGGCGCTCGTCGCCCCCTCGCCCCCCTTTTGTGGGTGGGGACCTCGCGTCTCCTGCCCGCAAACCGAACCCCGGCGCGGAACGCGCCAAGGAAATCTAACCAAGAGAGCCATGCCGGAGGCCCCGGACACGGTGCGCCCCCGGCGTCGGCGTCTTATGAATTATTCAAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAATCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCCCCAAACTCCGGTTTGGGCGGGGCGGAAGTTGGCCTCCCGTGCGTGCCTGCGCGCGCGGTTAGCCCAAAAGCGAGTCCTCGGCGACGAGCGCCACGACAATCGGTGGTTTTTTTACCCTCGTTCCTCGTCGTGCGTGCCCCGTCGCCCGAACGTGCTCTTGCGACCCTCACGCGTCGCCTCGGCGGCGCTCCCAACGCGACCCC

Click for details-----ITS1

TCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAATTGGTTACAACCGACGGGGGGTGGAGGGCGCTCGTCGCCCCCTCGCCCCCCTTTTGTGGGTGGGGACCTCGCGTCTCCTGCCCGCAAACCGAACCCCGGCGCGGAACGCGCCAAGGAAATCTAACCAAGAGAGCCATGCCGGAGGCCCCGGACACGGTGCGCCCCCGGCGTCGGCGTCTTATGAATTATTCAAAA

Click for details-----ITS2

ATCGTTGCCCCCCCAAACTCCGGTTTGGGCGGGGCGGAAGTTGGCCTCCCGTGCGTGCCTGCGCGCGCGGTTAGCCCAAAAGCGAGTCCTCGGCGACGAGCGCCACGACAATCGGTGGTTTTTTTACCCTCGTTCCTCGTCGTGCGTGCCCCGTCGCCCGAACGTGCTCTTGCGACCCTCACGCGTCGCCTCGGCGGCGCTCCCAACGCGACCCC
Taxonomic Information

Plant ID: NPO12416
Plant Latin Name: Quercus Mongolica
Taxonomy Genus: Quercus
Taxonomy Family: Fagaceae

Plant External Links:

NCBI TaxonomyDB: 103485
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; Russia

Traditional Medicine System:
TCM


Medicinal Functions:

Astringent

Geographical Distribution

China; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

147 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


67 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

55 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97534

Ingredient ID: NPC93201

Ingredient ID: NPC92319

Ingredient ID: NPC89909

Ingredient ID: NPC88584

Ingredient ID: NPC88354

Ingredient ID: NPC83425

Ingredient ID: NPC81831

Ingredient ID: NPC78441

Ingredient ID: NPC77625

Ingredient ID: NPC75441

Ingredient ID: NPC74017

Ingredient ID: NPC72447

Ingredient ID: NPC71690

Ingredient ID: NPC69513

Ingredient ID: NPC68426

Ingredient ID: NPC64190

Ingredient ID: NPC63941

Ingredient ID: NPC51700

Ingredient ID: NPC49074

Ingredient ID: NPC48128

Ingredient ID: NPC41481

Ingredient ID: NPC40394

Ingredient ID: NPC39730

Ingredient ID: NPC39602

Ingredient ID: NPC37649

Ingredient ID: NPC37087

Ingredient ID: NPC33103

Ingredient ID: NPC32311

Ingredient ID: NPC321194

Ingredient ID: NPC31187

Ingredient ID: NPC309066

Ingredient ID: NPC308489

Ingredient ID: NPC307063

Ingredient ID: NPC307050

Ingredient ID: NPC304962

Ingredient ID: NPC304905

Ingredient ID: NPC296697

Ingredient ID: NPC293908

Ingredient ID: NPC293664

Ingredient ID: NPC292705

Ingredient ID: NPC29157

Ingredient ID: NPC290598

Ingredient ID: NPC289774

Ingredient ID: NPC287430

Ingredient ID: NPC287063

Ingredient ID: NPC285965

Ingredient ID: NPC285951

Ingredient ID: NPC284288

Ingredient ID: NPC283389

Ingredient ID: NPC283184

Ingredient ID: NPC280576

Ingredient ID: NPC279886

Ingredient ID: NPC27790

Ingredient ID: NPC277458

Ingredient ID: NPC27377

Ingredient ID: NPC272824

Ingredient ID: NPC270043

Ingredient ID: NPC268794

Ingredient ID: NPC267856

Ingredient ID: NPC266020

Ingredient ID: NPC265077

Ingredient ID: NPC264317

Ingredient ID: NPC261933

Ingredient ID: NPC26029

Ingredient ID: NPC248830

Ingredient ID: NPC248747

Ingredient ID: NPC248521

Ingredient ID: NPC248355

Ingredient ID: NPC248132

Ingredient ID: NPC242733

Ingredient ID: NPC241943

Ingredient ID: NPC241427

Ingredient ID: NPC237875

Ingredient ID: NPC232673

Ingredient ID: NPC231810

Ingredient ID: NPC23060

Ingredient ID: NPC230387

Ingredient ID: NPC230124

Ingredient ID: NPC228383

Ingredient ID: NPC227467

Ingredient ID: NPC225467

Ingredient ID: NPC220825

Ingredient ID: NPC219876

Ingredient ID: NPC219205

Ingredient ID: NPC217635

Ingredient ID: NPC216127

Ingredient ID: NPC215833

Ingredient ID: NPC215072

Ingredient ID: NPC214243

Ingredient ID: NPC212556

Ingredient ID: NPC211230

Ingredient ID: NPC209846

Ingredient ID: NPC201459

Ingredient ID: NPC196238

Ingredient ID: NPC194882

Ingredient ID: NPC194251

Ingredient ID: NPC193210

Ingredient ID: NPC189417

Ingredient ID: NPC1890

Ingredient ID: NPC18872

Ingredient ID: NPC185977

Ingredient ID: NPC18536

Ingredient ID: NPC185045

Ingredient ID: NPC184613

Ingredient ID: NPC179256

Ingredient ID: NPC178383

Ingredient ID: NPC176679

Ingredient ID: NPC174205

Ingredient ID: NPC173790

Ingredient ID: NPC171434

Ingredient ID: NPC169497

Ingredient ID: NPC168615

Ingredient ID: NPC167317

Ingredient ID: NPC164365

Ingredient ID: NPC161875

Ingredient ID: NPC158168

Ingredient ID: NPC152384

Ingredient ID: NPC147124

Ingredient ID: NPC145876

Ingredient ID: NPC145009

Ingredient ID: NPC142990

Ingredient ID: NPC142754

Ingredient ID: NPC142415

Ingredient ID: NPC137037

Ingredient ID: NPC136099

Ingredient ID: NPC13114

Ingredient ID: NPC129228

Ingredient ID: NPC126029

Ingredient ID: NPC124492

Ingredient ID: NPC123965

Ingredient ID: NPC123463

Ingredient ID: NPC123324

Ingredient ID: NPC121162

Ingredient ID: NPC120968

Ingredient ID: NPC118971

Ingredient ID: NPC11724

Ingredient ID: NPC114590

Ingredient ID: NPC106364

Ingredient ID: NPC105863

Ingredient ID: NPC105189

Ingredient ID: NPC103754

Ingredient ID: NPC103647

Ingredient ID: NPC103082

Ingredient ID: NPC101475

Ingredient ID: NPC100702

Ingredient ID: NPC100127