CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Smilax Menispermoidea

Example Image

PLANiTS DNA barcode

CCGCGAACTCGAAACGGACGCCGCCGGAGCGGGCGGGCACGCCCGTCCCTCCGGCCCGTCGCCTCTCGGGCCGCGTCCGCCCTGTGCGGCGCGTCCCGGCAGGCGGAGGACACATCCCGGCGCGGCGCGCGCCAAGGAACGACCGTCGGAACAGGGCTCCGCCCCCGCCCGCGCGGCGGGGCGGCGCCTCGCTCTACTCGAAACTGTA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO12396
Plant Latin Name: Smilax Menispermoidea
Taxonomy Genus: Smilax
Taxonomy Family: Smilacaceae

Plant External Links:

NCBI TaxonomyDB: 1045158
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

5 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

3 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC76594

Ingredient ID: NPC37288

Ingredient ID: NPC34864

Ingredient ID: NPC320280

Ingredient ID: NPC316950

Ingredient ID: NPC273855

Ingredient ID: NPC248573

Ingredient ID: NPC234689

Ingredient ID: NPC202306

Ingredient ID: NPC161571

Ingredient ID: NPC155620

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 3	CYP3A4	Cytochrome P450 3A4	P08684	CHEMBL340
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Enzyme	ALOX12	Arachidonate 12-lipoxygenase	P18054	CHEMBL3687
Therapeutic Target	Enzyme	GFER	FAD-linked sulfhydryl oxidase ALR	P55789	CHEMBL1741189
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Lyase	GLO1	Glyoxalase I	Q04760	CHEMBL2424
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA14	Carbonic anhydrase XIV	Q9ULX7	CHEMBL3510
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR1	Estrogen receptor alpha	P03372	CHEMBL206
Therapeutic Target	Oxidoreductase	ALOX5	Arachidonate 5-lipoxygenase	P09917	CHEMBL215
Therapeutic Target	Oxidoreductase	HSD17B10	Endoplasmic reticulum-associated amyloid beta-peptide-binding protein	Q99714	CHEMBL4159
Therapeutic Target	Oxidoreductase	NQO2	Quinone reductase 2	P16083	CHEMBL3959
Therapeutic Target	Oxidoreductase	PTGS2	Cyclooxygenase-2	P35354	CHEMBL230
Therapeutic Target	Peptide receptor (family A GPCR)	NPSR1	Neuropeptide S receptor	Q6W5P4	CHEMBL5162
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	CDK1	Cyclin-dependent kinase 1	P06493	CHEMBL308
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Protein Kinase	PIM1	Serine/threonine-protein kinase PIM1	P11309	CHEMBL2147
Therapeutic Target	Protein Kinase	AXL	Tyrosine-protein kinase receptor UFO	P30530	CHEMBL4895
Therapeutic Target	Protein Kinase	IGF1R	Insulin-like growth factor I receptor	P08069	CHEMBL1957
Therapeutic Target	Protein Kinase	YES1	Tyrosine-protein kinase YES	P07947	CHEMBL2073
Therapeutic Target	Protein Kinase	AURKB	Serine/threonine-protein kinase Aurora-B	Q96GD4	CHEMBL2185
Therapeutic Target	Protein Kinase	FLT3	Tyrosine-protein kinase receptor FLT3	P36888	CHEMBL1974
Therapeutic Target	Protein Kinase	MET	Hepatocyte growth factor receptor	P08581	CHEMBL3717
Therapeutic Target	Serine protease	DPP4	Dipeptidyl peptidase IV	P27487	CHEMBL284
Therapeutic Target	Transferase	PIK3CA	PI3-kinase p110-alpha subunit	P42336	CHEMBL4005
Therapeutic Target	Transferase	PIK3CB	PI3-kinase p110-beta subunit	P42338	CHEMBL3145
Therapeutic Target	Transient receptor potential channel	TRPA1	Transient receptor potential cation channel subfamily A member 1	O75762	CHEMBL6007

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	64

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT02549924	Effect of Administration of Resveratrol on Glycemic Variability in Individuals With Type 2 Diabetes Mellitus	type 2 diabetes mellitus	Resveratrol (NPC161571)	NP level
NCT04853199	Quercetin In The Treatment Of SARS-COV 2	COVID-19	Quercetin (NPC20791)	NP level
NCT04867252	Effects of Combined Resveratrol and Myo-inositol on Altered Metabolic, Endocrine Parameters and Perceived Stress in Patients With Polycystic Ovarian Syndrome	polycystic ovary syndrome	Resveratrol (NPC161571)	NP level
NCT02226484	Can Quercetin Increase Claudin-4 and Improve Esophageal Barrier Function in GERD?	gastroesophageal reflux disease	Quercetin (NPC20791)	NP level
NCT00433576	Resveratrol in Treating Patients With Colorectal Cancer That Can Be Removed By Surgery	colorectal adenocarcinoma;malignant colon neoplasm;rectum cancer	Resveratrol (NPC161571)	NP level
NCT02261844	Resveratrol and Human Hepatocyte Function in Cancer	liver cancer	Resveratrol (NPC161571)	NP level
NCT01492114	Anti-inflammatory and Antioxidant Effects of Resveratrol on Healthy Adults.	inflammation	Resveratrol (NPC161571)	NP level
NCT03943459	Sirtuin-1 and Advanced Glycation End-products in Postmenopausal Women With Coronary Disease	coronary artery disease	Quercetin (NPC20791)	NP level
NCT03095105	Pharmacokinetic Profile of BIA 6-512 in Healthy Elderly Subjects Versus Healthy Young Subjects	Parkinson disease	Resveratrol (NPC161571)	NP level
NCT02062190	Resveratrol, Cardiovascular Risk Markers And Cognitive Performance In Patients With Schizophrenia	schizophrenia	Resveratrol (NPC161571)	NP level
NCT03743636	Nicotinamide Riboside With and Without Resveratrol to Improve Functioning in Peripheral Artery Disease	peripheral arterial disease	Resveratrol (NPC161571)	NP level
NCT02433925	Resveratrol's Effects on Inflammation and Oxidative Stress in Chronic Kidney Disease	chronic kidney disease	Resveratrol (NPC161571)	NP level
NCT01375101	Therapeutic Effect of Quercetin and the Current Treatment of Erosive and Atrophic Oral Lichen Planus	oral lichen planus	Quercetin (NPC20791)	NP level
NCT02523274	Resveratrol and Exercise to Treat Functional Limitations in Late Life	aging	Resveratrol (NPC161571)	NP level
NCT02848131	Senescence in Chronic Kidney Disease	chronic kidney disease	Quercetin (NPC20791)	NP level
NCT01839344	Effects of Quercetin on Blood Sugar and Blood Vessel Function in Type 2 Diabetes.	type 2 diabetes mellitus	Quercetin (NPC20791)	NP level
NCT02245932	Resveratrol In Chronic Obstructive Pulmonary Disease (COPD) Patients (CARMENS-trial)	chronic obstructive pulmonary disease	Resveratrol (NPC161571)	NP level
NCT02409537	Effects of Dietary Antioxidants to Prevent Cardiovascular Disease	Hypercholesterolemia	Resveratrol (NPC161571)	NP level
NCT01348204	Nasal Potential Studies Utilizing Cystic Fibrosis Transmembrane Regulator (CFTR) Modulators	cystic fibrosis	Quercetin (NPC20791)	NP level
NCT01914081	Resveratrol: A Potential Anti- Remodeling Agent in Heart Failure, From Bench to Bedside	dilated cardiomyopathy	Resveratrol (NPC161571)	NP level
NCT02219906	Resveratrol in Metabolic Syndrome: Effect on Platelet Hyper-reactivity and HDL Lipid Peroxidation	metabolic syndrome	Resveratrol (NPC161571)	NP level
NCT02314208	Therapeutic Metabolic Intervention in Patients With Spastic Paraplegia SPG5	Spastic paraplegia	Resveratrol (NPC161571)	NP level
NCT01912820	Effect of Quercetin on Green Tea Polyphenol Uptake in Prostate Tissue From Patients With Prostate Cancer Undergoing Surgery	prostate adenocarcinoma	Quercetin (NPC20791)	NP level
NCT03989271	Biological Effects of Quercetin in COPD	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT03091868	Pharmacokinetics of Rising Single-doses of BIA 6-512 and Their Effect on the Levodopa Pharmacokinetics	Parkinson disease	Resveratrol (NPC161571)	NP level
NCT03446625	Resveratrol as a Preventive Treatment of OHSS	infertility	Resveratrol (NPC161571)	NP level
NCT04733534	An Open-Label Intervention Trial to Reduce Senescence and Improve Frailty in Adult Survivors of Childhood Cancer	childhood cancer	Quercetin (NPC20791)	NP level
NCT04400890	Randomized Proof-of-Concept Trial to Evaluate the Safety and Explore the Effectiveness of Resveratrol, a Plant Polyphenol, for COVID-19	COVID-19	Resveratrol (NPC161571)	NP level
NCT01842399	Resveratrol and Cardiovascular Health in the Elderly	hypertension	Resveratrol (NPC161571)	NP level
NCT04907253	Quercetin in Coronary Artery By-pass Surgery	coronary artery disease	Quercetin (NPC20791)	NP level
NCT03095092	Effect of Food on BIA 6-512 (Trans-resveratrol)	Parkinson disease	Resveratrol (NPC161571)	NP level
NCT02905799	Resveratrol in Knee Osteoarthritis	osteoarthritis	Resveratrol (NPC161571)	NP level
NCT00654667	Mechanisms of Metabolic Regulation of Resveratrol on Humans With Metabolic Syndrome	insulin resistance	Resveratrol (NPC161571)	NP level
NCT04542993	Can SARS-CoV-2 Viral Load and COVID-19 Disease Severity be Reduced by Resveratrol-assisted Zinc Therapy	COVID-19;severe acute respiratory syndrome	Resveratrol (NPC161571)	NP level
NCT00098969	UMCC 2003-064 Resveratrol in Preventing Cancer in Healthy Participants	neoplasm	Resveratrol (NPC161571)	NP level
NCT01504854	Resveratrol for Alzheimer's Disease	Alzheimer disease	Resveratrol (NPC161571)	NP level
NCT02114892	Effect of Resveratrol Administration on Metabolic Syndrome, Insulin Sensitivity and Insulin Secretion	metabolic syndrome	Resveratrol (NPC161571)	NP level
NCT05456022	Therapeutic Efficacy of Quercetin Versus Its Encapsulated Nanoparticle on Tongue Squamous Cell Carcinoma Cell Line	mouth neoplasm	Quercetin (NPC20791)	NP level
NCT02704494	Resveratrol's Effects in Diabetic Nephropathy	diabetic nephropathy	Resveratrol (NPC161571)	NP level
NCT01564381	Effects of Resveratrol Supplements on Vascular Health in Postmenopausal Women	cardiovascular disease	Resveratrol (NPC161571)	NP level
NCT03093389	Tolerability and Steady-state Pharmacokinetics of BIA 6-512	Parkinson disease	Resveratrol (NPC161571)	NP level
NCT04449198	Type 1 Diabetes, Endothelin, and Skeletal Muscle Mitochondrial Dysfunction: The Role of Sirtuin-1	type 1 diabetes mellitus	Resveratrol (NPC161571)	NP level
NCT02130440	Evaluation of the Beneficial Effects of a Nasal Spray of Resveratrol in Children With Seasonal Allergic Rhinitis	seasonal allergic rhinitis	Resveratrol (NPC161571)	NP level
NCT00256334	Resveratrol for Patients With Colon Cancer	malignant colon neoplasm	Resveratrol (NPC161571)	NP level
NCT01677611	Effects of Resveratrol in Patients With Type 2 Diabetes	type 2 diabetes mellitus	Resveratrol (NPC161571)	NP level
NCT05422885	Safety and Feasibility of Dasatinib and Quercetin in Adults at Risk for Alzheimer's Disease	aging	Quercetin (NPC20791)	NP level
NCT01126229	Resveratrol for Improved Performance in the Elderly	memory impairment	Resveratrol (NPC161571)	NP level
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Quercetin (NPC20791);Resveratrol (NPC161571)	NP level
NCT01708278	Beneficial Effects of Quercetin in Chronic Obstructive Pulmonary Disease (COPD)	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT05276895	Effect of Natural Senolytic Agents & NLRP3 Inhibitors on Osteoarthritis	osteoarthritis	Quercetin (NPC20791)	NP level
NCT02030977	The Effects of Resveratrol Supplement on Biochemical Factors and Hepatic Fibrosis in Patients With Nonalcoholic Steatohepatitis	non-alcoholic fatty liver disease	Resveratrol (NPC161571)	NP level
NCT03091543	Tolerability, Safety and Pharmacokinetics of Four Single-doses of BIA 6-512 (Trans-resveratrol) and Their Effect on the Levodopa Pharmacokinetics	Parkinson disease	Resveratrol (NPC161571)	NP level
NCT03253913	Resveratrol and Sirolimus in Lymphangioleiomyomatosis Trial	lymphangioleiomyomatosis	Resveratrol (NPC161571)	NP level
NCT03933163	Micronised Resveratrol as a Treatment for Friedreich Ataxia	Friedreich ataxia	Resveratrol (NPC161571)	NP level
NCT01720147	Quercetin in Children With Fanconi Anemia; a Pilot Study	Fanconi anemia	Quercetin (NPC20791)	NP level
NCT04851821	The Effectiveness of Phytotherapy in SARS-COV2(COVID-19)	COVID-19	Quercetin (NPC20791)	NP level
NCT01321151	Use of Resveratrol to Decrease Acute Secondary Brain Injury Following Sports-Related Concussions in Boxers	concussion	Resveratrol (NPC161571)	NP level
NCT01438320	Q-Trial in Patients With Hepatitis C	chronic hepatitis C virus infection	Quercetin (NPC20791)	NP level
NCT01339884	A Study of Resveratrol as Treatment for Friedreich Ataxia	Friedreich ataxia	Resveratrol (NPC161571)	NP level
NCT03097211	Effect of BIA 6-512 at Steady-state on the Levodopa Pharmacokinetics With a Single-dose of Levodopa/Benserazide 200/50 mg or With a Single-dose of Levodopa/Benserazide 200/50 mg Plus a Single-dose of Nebicapone 150 mg	Parkinson disease	Resveratrol (NPC161571)	NP level
NCT05062486	A Study to Evaluate the Safety and Efficacy of RQC for AMD	age-related macular degeneration	Resveratrol (NPC161571);Quercetin (NPC20791)	NP level
NCT04946383	Safety and Effectivness of Quercetin & Dasatinib on Epigenetic Aging	aging	Quercetin (NPC20791)	NP level
NCT02336633	Resveratrol and Huntington Disease	Huntington disease	Resveratrol (NPC161571)	NP level
NCT03094156	Effect of BIA 6-512 at Steady-state on the Levodopa Pharmacokinetics	Parkinson disease	Resveratrol (NPC161571)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	KDR,PIK3CA,PIK3CB,FLT3,PTGS1,EGFR,MET,TP53,IGF1R
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	IGF1R,EGFR,KDR,AXL,MET,CDK1,FLT3,ALOX5
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,NPSR1,TRPA1,ALOX12,CA9,XDH,CDK1,AURKB
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	FLT3,TRPA1,HSD17B10,CYP1B1,CYP3A4,CA9,ALOX15,DPP4
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	CDK1,PIK3CA,TP53,DPP4,AURKB,FLT3,SRC
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12,NOX4,CYP19A1,AURKB,CDK1,SRC,IGF1R
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	NOX4,CYP19A1,ALOX15,CDK1,MET,AURKB,NPSR1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12,NOX4,ALOX5,CYP1B1,XDH,MET,DPP4
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,TRPA1,CA9,XDH,CDK1,AURKB,NPSR1
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP1A1,AURKB,CA9,XDH,ALOX15,CDK1,NPSR1
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	KDR,SRC,MET,PTGS1,PTGS2 NCT01564381
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	PIM1,FLT3,SRC,TP53,AURKB,AXL
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	KDR,MET,ESR1,SRC,EGFR,TP53
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	PTGS1,PTGS2,FLT3,MET,KDR NCT01504854
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	EGFR,MET,CSNK2A1,KDR,IGF1R NCT02261844
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	PTGS2,DPP4,PTGS1 NCT01839344,NCT02549924,NCT01677611
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	NOX4,TRPA1,CA9,AURKB,NPSR1,PTGS2
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12,TRPA1,ESR1,CA9,CDK1,AURKB
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12,CYP1A1,CYP3A4,MET,AURKB,CYP1A2
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	FLT3,MET,KDR,SRC,TP53
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	IGF1R,ALOX5,PTGS1,PTGS2,PIK3CB
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	SRC,KDR,IGF1R,AXL,FLT3
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	NOX4,CA14,PTGS1,XDH,MET
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	CYP19A1,MET,AXL,DPP4,PTGS2
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	NOX4,CYP1A1,CA9,MET,NPSR1
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,CA9,XDH,CDK1,AURKB
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	NQO2,LMNA,SRC,DPP4,PTGS2
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	NOX4,ALOX15,CDK1,AURKB,NPSR1
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CYP1A2,CYP3A4,CA9,CDK1,AURKB
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CYP1A1,CA14,PIK3CB,ALOX15,CYP2C19
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA,CYP19A1,EGFR,XDH,AXL
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	NOX4,TRPA1,CYP1B1,ESR1,DPP4
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AURKB,ESR1,PIK3CB,PIK3CA
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	ALOX5,SRC,PTGS1,PTGS2
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	TP53,KDR,EGFR,MET
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	MET,TP53,KDR,EGFR
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	ESR1,PTGS2,PTGS1,CYP19A1
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	KDR,CA9,EGFR,MET
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	PTGS1,PTGS2,ALOX5,CYP3A4
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	TP53,FLT3,SRC,KDR
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	XDH,IGF1R NCT02433925,NCT02848131
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	PTGS2,KDR,EGFR,FLT3
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	EGFR,AXL,TP53,SRC
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	ALOX5,ABCG2,PTGS1,PTGS2
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	MET,PIK3CB,KDR,EGFR
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	EGFR,TP53,IGF1R,SRC
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	EGFR,KDR,TP53,AXL
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	PTGS1,PTGS2 NCT05276895,NCT02905799
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04400890,NCT04853199,NCT04851821,NCT04542993
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	NOX4,FLT3,TRPA1,DPP4
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	FLT3,MET,AXL,PTGS2
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	TRPA1,PTGS1,CYP19A1
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	PTGS1,PTGS2,ESR1
NA Disease Category: NA Disease ICD-11 Code: NA	NOX4,MET NCT01492114
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	MET,KDR,EGFR
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	KDR,SRC,MET
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDR,MET,EGFR
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	FLT3,DPP4,ALOX5
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	ESR1,PTGS2,PTGS1
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4,PTGS2,PTGS1
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	ALOX5,GLO1,XDH
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	DPP4,KDR,AURKB
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4 NCT02219906,NCT02114892
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	EGFR,ALOX5,CDK1
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	IGF1R,ESR1,ALOX5
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	TP53,MET,DPP4
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	NCT02245932,NCT01708278,NCT03989271
Ageing associated decline in intrinsic capacity Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG2A	NCT05422885,NCT04946383,NCT02523274
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	NOX4,ALOX15 NCT01912820
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12,TRPA1,CDK1
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	NOX4,ABCG2,IGF1R
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	ABCG2,CYP1B1,PTGS2
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	NQO2,PTGS2,CA14,ESR1,CYP3A4,PIK3CA,TP53,CA9,CSNK2A1,MET,ALOX5,XDH,POLB,SRC,PIK3CB,AXL,PIM1,FLT3,AURKB,YES1,PTGS1,IGF1R,CA12,EGFR,CDK1,KDR
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	TRPA1,PTGS1,ALOX15,CYP2C19,ABCG2,AURKB,CA9,XDH,POLB,RECQL,DPP4,PIM1,LMNA,CYP1B1,PTGS2,ALOX5,CA14,MET,AXL,NPSR1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	KDR,TRPA1,PTGS1,ALOX15,CSNK2A2,AURKB,CA9,XDH,RECQL,DPP4,PIM1,LMNA,EGFR,CDK1,CA12,ALOX5,FLT3,SRC,MET,AXL
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	IGF1R,SRC
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	FLT3,CDK1
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA14,CA12
Inherited coagulation factor deficiency Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B14	PTGS1,PTGS2
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	FLT3,SRC
Reactive arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA11	PTGS2,PTGS1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	ESR1,SRC
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	EGFR,CA9
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	PTGS2,PTGS1
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	FLT3,ALOX5
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	ALOX5,PTGS2
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	EGFR,SRC
Inflammatory spondyloarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA92	PTGS1,PTGS2
Male infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB04	ESR1 NCT03446625
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	EGFR,MET
HIV-infected patients with tuberculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1B10-1B14	PTGS1,PTGS2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	ALOX5,KDR
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	PIK3CA NCT00455416
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	PTGS2,PTGS1
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	TP53,SRC
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	PTGS1,PTGS2
Unspecified viral infection of unspecified site Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D9Z	ESR1,FLT3
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	SRC,KDR
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	PTGS1 NOX4
Urinary system disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GC2Z	PTGS2,PTGS1
Joint pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME82	PTGS2,PTGS1
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12,PTGS1
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	DPP4,ESR1
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	KDR,SRC
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	KDR,MET
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	SRC,FLT3
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	TP53,SRC
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	SRC,TP53
Spinal pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME84	PTGS1,PTGS2
Otitis media Disease Category: 10.Diseases of the ear or mastoid process Disease ICD-11 Code: AA80-AB0Z	PTGS1,PTGS2
Malignant neoplasms of colon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	NCT00256334,NCT00433576
Friedreich ataxia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A03.10	NCT03933163,NCT01339884
coronary artery disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA8Y-BA8Z	NCT04907253,NCT03943459
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CDK1,CYP1A1
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	AURKB,ABCG2
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	ABCG2,CA14
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4,TRPA1
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1,CA9
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	CYP1A1,YES1
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	MET,AXL
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	NOX4,PTGS1
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	KDR,TRPA1,HSD17B10,MET,CSNK2A2,AURKB,CA9,RECQL,NOX4,LMNA,EGFR,CDK1,GFER,CA12,GLO1,TP53,SRC,AXL
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	TRPA1,HSD17B10,PTGS1,CYP19A1,ALOX15,CA9,XDH,POLB,DPP4,YES1,PTGS2,GLO1,CA14,TP53,MET,AURKB,NPSR1
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	KDR,TRPA1,PTGS1,ABCG2,XDH,DPP4,NOX4,ALOX12,CDK1,CA12,ALOX5,GLO1,CA14,PIK3CB,MET,NPSR1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CYP19A1,PIK3CB,CDK1,KDR,SRC,CA14,CA9,PIK3CA,EGFR,IGF1R,MET,CA12,AXL,NQO2,ESR1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12,NOX4,ALOX5,GLO1,CSNK2A3,TP53,PIK3CB,ALOX12,ESR1,CA9,XDH,ALOX15,YES1,MET,CYP1A2
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	TRPA1,PTGS1,CA9,NOX4,LMNA,ALOX12,CDK1,ALOX5,CSNK2A3,TP53,SRC,IGF1R,AURKB
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,NOX4,CYP19A1,AURKB,CA9,CDK1,CA12,CYP19A1,CA9,CDK1,SRC,AURKB
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	TRPA1,ALOX5,CYP19A1,CA9,XDH,MET,AURKB,TRPA1,ALOX5,CA9,AURKB
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,KDR,LMNA,CSNK2A3,CYP1B1,CYP19A1,PTGS1,CA9,MET,DPP4,PTGS2
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	PTGS2,SRC,PTGS1 NCT03097211,NCT03093389,NCT03091868,NCT03095092,NCT03095105,NCT03091543,NCT03094156
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,NOX4,GLO1,CYP19A1,CYP3A4,CA9,CDK1,MET,AURKB,DPP4
Inborn metabolism deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5C59	CA14
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	XDH
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	MET
Encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E47	XDH
Ovarian dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80	TP53
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Female genital tract noninflammatory disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA1Y	ESR1
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	FLT3
Kidney failure Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB60-GB6Z	TP53
Vaginitis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA02	ESR1
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	TP53
Metastatic liver/bile duct neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D80	TP53
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	EGFR
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR
Filariasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F66	ALOX5
Breast in situ carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E65	ESR1
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	MET
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	CYP3A4
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	SRC
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	PTGS1
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	EGFR
Vasculitis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A44	PTGS1
Carcinoid syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B10	ALOX5
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	NQO2
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	IGF1R
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	CYP19A1
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	MET
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	TP53
Knee osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA01	PTGS2
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Adrenal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	ESR1
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	ESR1
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Leiomyosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B58	SRC
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	FLT3
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	FLT3
Extraocular muscle disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C82	IGF1R
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	XDH
Upper respiratory tract disorder Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0Z	TRPA1
Mineral deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B5K	XDH
Eye anterior segment structural developmental anomaly Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA11	PTGS1
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	FLT3
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	EGFR
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	ABCG2
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	SRC
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	IGF1R
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Menopausal disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA30	ESR1
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	FLT3
Dyspareunia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA12	ESR1
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	TP53
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	ALOX5
Lip/oral cavity/pharynx neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6E	TP53
Skeletal anomaly Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD24	ESR1
Menstrual cycle bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20	ESR1
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	FLT3
Liposarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B59	TP53
Acquired prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E01	ESR1
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	IGF1R
Metastatic malignant neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E09	AXL
Ulcerative colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD71	PTGS1
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	ESR1
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Female infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA31	ESR1
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	PTGS1
Ataxic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A03	PTGS1
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	FLT3
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Metastatic tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E2Z	ESR1
Inborn purine/pyrimidine/nucleotide metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C55	XDH
Metastatic digestive system neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D8Y	SRC
Synovial sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5A	SRC
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Human immunodeficiency virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C60-1C62	FLT3
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
Paraplegia Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB56	NCT02314208
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	NCT02130440
Concussion Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NA07.0	NCT01321151
Cystic fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA25	NCT01348204
Severe acute respiratory syndrome Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D65	NCT04542993
Cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43	NCT01914081
Insulin-resistance syndromes Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A44	NCT00654667
Age-associated cognitive decline Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB21.0	NCT01126229
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	NCT02030977
Chronic hepatitis C Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E51.1	NCT01438320
Lichen planus Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA91	NCT01375101
Type1diabetesmellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A10	NCT04449198
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	NCT02062190
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	NCT04867252
Lymphangioleiomyomatosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB07	NCT03253913
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT04733534
Chronic arterial occlusive disease, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	NCT03743636
Other specified malignant neoplasms of colon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	NCT00433576
Chronic kidney disease, stage unspecified Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61.Z	NCT02704494
Malignant neoplasms of other or unspecified parts of mouth Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B66	NCT05456022
Hypercholesterolaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80.0	NCT02409537
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	NCT01842399
Congenital aplastic anaemia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A70.0	NCT01720147
Macular degeneration Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B75	NCT05062486
Huntington disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01.10	NCT02336633
Neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 02	NCT00098969
Gastro-oesophageal reflux disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA22	NCT02226484
Rectum cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B92	NCT00433576
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	PTGS2
Non-alcoholic steatohepatitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92.1	PTGS2
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	PIM1
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	NOX4
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	AXL
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Malignant neoplasms of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	PTGS2
Dilated cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43.0	ABCG2
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MET

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Smilax Menispermoidea

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

11 All known Ingredients in Total

5 Ingredients with Acceptable Bioavailablity

3 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Colorectal cancer

Lung cancer

Squamous cell carcinoma of bronchus or lung

Malignant neoplasms of thymus

Malignant haematopoietic neoplasm

Hepatoblastoma

Adenocarcinoma of stomach

Malignant neoplasms of thyroid gland, unspecified

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Cardiovascular disease

Acute myeloid leukaemia

Brain cancer

Alzheimer disease

Liver cancer

Type 2 diabetes mellitus

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Invasive carcinoma of breast

Renal cell carcinoma, chromophobe type

Ovarian cancer

Pain, unspecified

Multiple myeloma

Pheochromocytoma

West Nile virus infection

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of bronchus or lung

Superficial ovarian endometriosis

Malignant neoplasms of oesophagus

Urothelial carcinoma of bladder

Cytomegaloviral disease

Chikungunya virus disease

Carpal tunnel syndrome

Prostate cancer

Postoperative inflammation

Stomach cancer

Head and neck cancer

Endometriosis

Renal cell carcinoma

Atopic eczema

Peritoneal cancer

Chronic kidney disease

Chronic pain

Mature B-cell leukaemia

Rheumatoid arthritis

Metastatic lymph node neoplasm

Pancreatic cancer

Myelodysplastic syndrome

Osteoarthritis

COVID-19

Leishmaniasis

Human immunodeficiency virus disease without mention of tuberculosis or malaria

Neuropathy

Female pelvic pain

NA

Melanoma

Pleomorphic sarcoma

Non-small cell lung cancer

Psoriasis

Hyper-lipoproteinaemia

Myocardial infarction

Influenza

Acute diabete complication

Metabolic disorder

Nasopharyngeal cancer