• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Smilax Menispermoidea


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

CCGCGAACTCGAAACGGACGCCGCCGGAGCGGGCGGGCACGCCCGTCCCTCCGGCCCGTCGCCTCTCGGGCCGCGTCCGCCCTGTGCGGCGCGTCCCGGCAGGCGGAGGACACATCCCGGCGCGGCGCGCGCCAAGGAACGACCGTCGGAACAGGGCTCCGCCCCCGCCCGCGCGGCGGGGCGGCGCCTCGCTCTACTCGAAACTGTA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO12396
Plant Latin Name: Smilax Menispermoidea
Taxonomy Genus: Smilax
Taxonomy Family: Smilacaceae

Plant External Links:

NCBI TaxonomyDB: 1045158
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


5 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

3 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC76594

Ingredient ID: NPC37288

Ingredient ID: NPC34864

Ingredient ID: NPC320280

Ingredient ID: NPC316950

Ingredient ID: NPC273855

Ingredient ID: NPC248573

Ingredient ID: NPC234689

Ingredient ID: NPC202306

Ingredient ID: NPC161571

Ingredient ID: NPC155620