• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Erycibe Schmidtii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCCAGCAGAACGACCCGCGAACGCGTTTGTTTATCCTCTTCCGTCGGGGATGGGGCTCCGTCCCCGTCCCGGACGAACAACGAACCCCCCGGCGCGGAACGCGCCAAGGAATACCCCAACGAGACGGCCAGCCGCCCGCGCTCCGTTCGCGGCCCGCGCGGGGGGCGTCGGCGTCTTACTTAACAAAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGCGTCGCCCCCCCTCAGCGACCCCGCGTCGTTTTGGGAGGGGGAGCGGACGATGGCCTCCCGTGCCCCTGCCCGGGGCGCGGCTGGCCCAAACGCGAGTCCCCGGCGACGGACGTCACGGCGAGTGGTGGTCGTACCCAGCGTGCATATCGTCGCGCCGTGCCCGTCGCCCGCGGGCTACAGGCCCTGCCGGGCCGCTCCGAGCGGCCCTCCGA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO12329
Plant Latin Name: Erycibe Schmidtii
Taxonomy Genus: Erycibe
Taxonomy Family: Convolvulaceae

Plant External Links:

NCBI TaxonomyDB: n.a.
Plant-of-the-World-Online: 267928-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

Myanmar; India; Cambodia; Vietnam; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

18 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


6 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC96294

Ingredient ID: NPC92774

Ingredient ID: NPC76336

Ingredient ID: NPC309355

Ingredient ID: NPC302857

Ingredient ID: NPC297517

Ingredient ID: NPC283790

Ingredient ID: NPC278068

Ingredient ID: NPC249797

Ingredient ID: NPC224389

Ingredient ID: NPC216630

Ingredient ID: NPC210040

Ingredient ID: NPC206095

Ingredient ID: NPC205003

Ingredient ID: NPC186653

Ingredient ID: NPC167976

Ingredient ID: NPC142703

Ingredient ID: NPC137949

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 2 CYP2D6 Cytochrome P450 2D6 P10635 CHEMBL289
Therapeutic Target Fatty acid binding protein family FABP4 Fatty acid binding protein adipocyte P15090 CHEMBL2083
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA9 Carbonic anhydrase IX Q16790 CHEMBL3594
Therapeutic Target Membrane receptor APP Beta amyloid A4 protein P05067 CHEMBL2487
Therapeutic Target Oxidoreductase AKR1B10 Aldo-keto reductase family 1 member B10 O60218 CHEMBL5983
Therapeutic Target Oxidoreductase AKR1B1 Aldose reductase P15121 CHEMBL1900
Therapeutic Target Small molecule receptor (family A GPCR) DRD1 Dopamine D1 receptor P21728 CHEMBL2056
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level6
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT03758014 Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Grade IV GBM Patients glioblastoma multiforme Chlorogenic Acid (NPC302857) NP level
NCT02245204 Phase I Studies of Chlorogenic Acid for Injection for Tolerance and Pharmacokinetic of Advanced Cancers cancer Chlorogenic Acid (NPC302857) NP level
NCT03751592 Phase Ib/IIa Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Advanced Lung Cancer lung cancer Chlorogenic Acid (NPC302857) NP level
NCT02728349 Tolerance and Pharmacokinetic Study of Chlorogenic Acid to Advanced Glioblastoma glioblastoma multiforme Chlorogenic Acid (NPC302857) NP level
NCT02621060 Effect of Chlorogenic Acid on Patients With Impaired Glucose Tolerance abnormal glucose tolerance Chlorogenic Acid (NPC302857) NP level
NCT02136342 Phase 1 Trial of Chlorogenic Acid in Patients With Advanced Cancer cancer Chlorogenic Acid (NPC302857) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 OR51E2,FABP5,CA9,AKR1B10,CA12,FABP4,CA12,AKR1B10,CA9
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 OR51E2,FABP5,AKR1B10,CA12,AKR1B1,FABP4
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 OR51E2,FABP5,CA9,CA12,AKR1B1,FABP4
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 CA9,AKR1B10,FABP5,OR51E2,FABP5,CA9
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 OR51E2,CA9,AKR1B10,APP,DRD1
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 OR51E2,CA9,AKR1B10,CA12,DRD1
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 CA9,AKR1B10,FABP5,DRD1,AKR1B1
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CA12,APP,FABP5,DRD1,AKR1B1
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 CA9,AKR1B10,FABP5,AKR1B1
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CA12,CA9,AKR1B10,FABP5
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 OR51E2,CA9,FABP5,AKR1B1
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 OR51E2,CA9,AKR1B10,CA12
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA12,CA9,AKR1B10,CYP2D6
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CA12,CA9,AKR1B10,FABP5
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 OR51E2,CA12,FABP5,CA9
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 APP,CA12,CA9
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 OR51E2,APP,FABP5
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 CA12,AKR1B10,CA9
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 AKR1B10,CYP2D6,CA9
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 AKR1B1,DRD1
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA12,CA9
Unspecified malignant neoplasms of unspecified sites
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D4Z
 NCT02245204,NCT02136342
Glioblastoma, primary, NOS
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH0MB1
 NCT03758014,NCT02728349
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 FABP5,AKR1B10
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 AKR1B10,AKR1B1
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 FABP4,CA9
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 AKR1B1,CA9
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 OR51E2,FABP5
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CA12,CA9
Dystrophic epidermolysis bullosa
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EC32
 APP
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 DRD1
Malaria
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F40-1F45
 CYP2D6
Cataract
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B10
 AKR1B1
Renal cell carcinoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90
 CA9
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 AKR1B1
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 AKR1B1
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA12
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 AKR1B1
Cocaine use disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C45
 DRD1
Allergic/hypersensitivity disorder
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A80-4A8Z
 DRD1
Tic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A05
 DRD1
Abortion
Disease Category: 18.Pregnancy, childbirth or the puerperium
Disease ICD-11 Code: JA00
 DRD1
Psychotic disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20-6A25
 DRD1
Thrombosis
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB61-GB90
 AKR1B1
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 AKR1B1
Insomnia
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A00-7A0Z
 CYP2D6
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 DRD1
Neuropathy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C0Z
 AKR1B1
Amyloidosis
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5D00
 APP
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 DRD1
Mature T-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A90
 CA9
Diagnostic imaging
Disease Category: NA
Disease ICD-11 Code: N.A.
 APP
Retinopathy
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B71
 APP
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 APP
Desmoid tumour
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2F7C
 APP
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA12
Impaired glucose tolerance
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A40.1
 NCT02621060
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 NCT03751592
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 DRD1
Non-alcoholic fatty liver disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DB92
 FABP4
Malignant neoplasms of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94
 FABP4
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 CA9
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 APP
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 KDM4E
Systemic sclerosis
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A42
 FABP4
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CA9
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA12
Malignant neoplasms of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 FABP4
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CA12
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 OR51E2
Malignant neoplasm of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 FABP4
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 AKR1B10

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group