• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ampelopsis Japonica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCTCTGCGTAGCAGAACGACCCGCGAACATGTTGCAACTCCTCGGGGGCGGAGCAGGGCGCGAGCCCGCCCGCTCCGCCTCCCGATTGAGAGGCCTCGGGAGCCCTGCCTGTCGTCGTGCCTTGTGCATGGGCCGGTGGGTGCTCTCGATGGCTCCTCTCAAACAAACAACGAACCCCGGCGCGGAAAGCGCCAAGGAACTCGAACGGAGCAACGCTCTCCCCATGCCCCGATCCCGGGTGCCTGGGCGAGATGTCGTCGTTTTCATAAATATTATATAGAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTCGAGGGCATGCCTGCCTGGGCGTCACCCACTCGTCGCCCCCCTCCACCCCAAAGCCGTGCGCTGGGGGATGCGGAGCGGGGGCGGACATTGGCCTCCCGTGGACGCCTTAGGTCCGCGGTTGGCCGAAAATCGGTCCCGCGGCGGCGTACGCCACGACAAGCGGTGGTCTAACAAACCCCTCCCCCCATCGAGGAGGAGAAGCCCGGAGTCGTGCGCGCCGCGTCGCCTCGGGGGCCCCCCGATCGAAAGGCCCGACACCCTCGA

Click for details-----ITS1

TCGAACCTCTGCGTAGCAGAACGACCCGCGAACATGTTGCAACTCCTCGGGGGCGGAGCAGGGCGCGAGCCCGCCCGCTCCGCCTCCCGATTGAGAGGCCTCGGGAGCCCTGCCTGTCGTCGTGCCTTGTGCATGGGCCGGTGGGTGCTCTCGATGGCTCCTCTCAAACAAACAACGAACCCCGGCGCGGAAAGCGCCAAGGAACTCGAACGGAGCAACGCTCTCCCCATGCCCCGATCCCGGGTGCCTGGGCGAGATGTCGTCGTTTTCATAAATATTATATAGAAA

Click for details-----ITS2

ACTCGTCGCCCCCCTCCACCCCAAAGCCGTGCGCTGGGGGATGCGGAGCGGGGGCGGACATTGGCCTCCCGTGGACGCCTTAGGTCCGCGGTTGGCCGAAAATCGGTCCCGCGGCGGCGTACGCCACGACAAGCGGTGGTCTAACAAACCCCTCCCCCCATCGAGGAGGAGAAGCCCGGAGTCGTGCGCGCCGCGTCGCCTCGGGGGCCCCCCGATCGAAAGGCCCGACACCCTCGA
Taxonomic Information

Plant ID: NPO12328
Plant Latin Name: Ampelopsis Japonica
Taxonomy Genus: Ampelopsis
Taxonomy Family: Vitaceae

Plant External Links:

NCBI TaxonomyDB: 714442
Plant-of-the-World-Online: 869647-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM


Medicinal Functions:

Anodyne; Antibacterial; Antifungal; Depurative; Febrifuge; Vulnerary

Geographical Distribution

Japan; China; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

60 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC98187

Ingredient ID: NPC97697

Ingredient ID: NPC97444

Ingredient ID: NPC9136

Ingredient ID: NPC88803

Ingredient ID: NPC79698

Ingredient ID: NPC72753

Ingredient ID: NPC68324

Ingredient ID: NPC66862

Ingredient ID: NPC61477

Ingredient ID: NPC55940

Ingredient ID: NPC55462

Ingredient ID: NPC47272

Ingredient ID: NPC44717

Ingredient ID: NPC43696

Ingredient ID: NPC4135

Ingredient ID: NPC325509

Ingredient ID: NPC322729

Ingredient ID: NPC318826

Ingredient ID: NPC31784

Ingredient ID: NPC29805

Ingredient ID: NPC265789

Ingredient ID: NPC262697

Ingredient ID: NPC261619

Ingredient ID: NPC236261

Ingredient ID: NPC233881

Ingredient ID: NPC230677

Ingredient ID: NPC229143

Ingredient ID: NPC225710

Ingredient ID: NPC221155

Ingredient ID: NPC219810

Ingredient ID: NPC216331

Ingredient ID: NPC208519

Ingredient ID: NPC20183

Ingredient ID: NPC199039

Ingredient ID: NPC197649

Ingredient ID: NPC19724

Ingredient ID: NPC19721

Ingredient ID: NPC185339

Ingredient ID: NPC184977

Ingredient ID: NPC184033

Ingredient ID: NPC176305

Ingredient ID: NPC175585

Ingredient ID: NPC171789

Ingredient ID: NPC166496

Ingredient ID: NPC164625

Ingredient ID: NPC161162

Ingredient ID: NPC147513

Ingredient ID: NPC144360

Ingredient ID: NPC1423

Ingredient ID: NPC141875

Ingredient ID: NPC138885

Ingredient ID: NPC132102

Ingredient ID: NPC127453

Ingredient ID: NPC126458

Ingredient ID: NPC124106

Ingredient ID: NPC116161

Ingredient ID: NPC114179

Ingredient ID: NPC11185

Ingredient ID: NPC109533

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Therapeutic Target Enzyme APEX1 DNA-(apurinic or apyrimidinic site) lyase P27695 CHEMBL5619
Therapeutic Target Hydrolase BCHE Butyrylcholinesterase P06276 CHEMBL1914
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Lysine demethylase KDM4E Lysine-specific demethylase 4D-like B2RXH2 CHEMBL1293226
Therapeutic Target Miscellaneous ion channel BCL2 Apoptosis regulator Bcl-2 P10415 CHEMBL4860
Therapeutic Target Phosphodiesterase TDP1 Tyrosyl-DNA phosphodiesterase 1 Q9NUW8 CHEMBL1075138
Therapeutic Target Structural protein LMNA Prelamin-A/C P02545 CHEMBL1293235
Therapeutic Target Transferase FUT7 Alpha-(1,3)-fucosyltransferase 7 Q11130 CHEMBL3596077
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level7
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT02964377 Plus Epicatechin Duchenne Muscular Dystrophy in Non-ambulatory Adolescents Duchenne muscular dystrophy (+)-Epicatechin (NPC261619) NP level
NCT03606694 Effect of Dihydromirycetin on Glycemic Control, Insulin Sensitivity and Insulin Secretion in Type 2 Diabetes Mellitus type 2 diabetes mellitus (2R,3R)-3,5,7-Trihydroxy-2-(3,4,5-Trihydroxyphenyl)-2,3-Dihydrochromen-4-One (NPC19721) NP level
NCT04386304 Safety and Biomarker Response to (+)-Epicatechin in Becker Muscular Dystrophy Becker muscular dystrophy (+)-Epicatechin (NPC261619) NP level
NCT01690676 Effect of an Apple Polyphenol Extract on Brachial Artery Flow-mediated Vasodilatory Function hypertension (+)-Epicatechin (NPC261619) NP level
NCT02660112 (+) Epicatechin to Treat Friedreich's Ataxia Friedreich ataxia (+)-Epicatechin (NPC261619) NP level
NCT02330276 Early Phase Pre-Clinical and Initial Clinical Research on Epicatechin prediabetes syndrome (+)-Epicatechin (NPC261619) NP level
NCT02656212 Early Phase Pre-Clinical and Initial Clinical Research on Epicatechin (Part 2) prediabetes syndrome (+)-Epicatechin (NPC261619) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CA7,TDP1,BCHE,APEX1,FUT7,LMNA
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 TDP1,BCL2,APEX1,HSD17B10,LMNA
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 FUT7,CA7,HSD17B10,TDP1
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 FUT7,LMNA,CA7,BCHE
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 TDP1,APEX1,FUT7
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 FUT7,BCL2,BCHE
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 FUT7,APEX1,HSD17B10
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 FUT7,CA7,BCHE
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 BCL2,APEX1
Intermediate hyperglycaemia, unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A40.Z
 NCT02330276,NCT02656212
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 LMNA,BCL2
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 BCHE,FUT7
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 FUT7,BCL2
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 FUT7,BCHE
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 BCL2
Mature B-cell leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A82
 BCL2
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 BCHE
Motor neuron disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8B60
 BCL2
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 BCL2
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 BCL2
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 BCL2
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 BCL2
Stomach cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72
 BCL2
Eexposure to noxious substances harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE61
 BCHE
Ocular cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D00-2D07
 APEX1
BCR-ABL1-negative chronic myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A41
 BCL2
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 BCHE
Follicular lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A80
 BCL2
Ovarian cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73
 BCL2
Chronic myelomonocytic leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A40
 BCL2
Tonus and reflex abnormality
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MB47
 BCHE
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 BCHE
Myeloproliferative neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A20
 BCL2
Pancreatic cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10
 BCL2
Diffuse large B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 BCL2
Mature B-cell lymphoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A85
 BCL2
Multiple myeloma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A83
 BCL2
Ovarian dysfunction
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80
 BCL2
Retinopathy
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B71
 APEX1
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 BCL2
Prostate cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82
 BCL2
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 BCL2
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 NCT03606694
Pulmonary hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BB01
 NCT01690676
Friedreich ataxia
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A03.10
 NCT02660112
Duchenne muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70.1
 NCT02964377
Becker muscular dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C70.0
 NCT04386304
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 FUT7
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 BCHE
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CA7
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 LMNA
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 KDM4E
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA7
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA7
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 LMNA
Polycystic ovary syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80.1
 FUT7
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 FUT7
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 LMNA
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 FUT7

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group