CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Viburnum Orientale

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCTAGCAGAACGACCCGCGAACACGTTTAATTACTAGGGTGCACCGGTCGGGGCGCGTCAGCCCCTGGCCGGTGCCCCCTCGGTCGGGACGCTCTTCGAGCGGCCCGGCCCAACAACGAACCCCGGCGCGATCTGCGCCAAGGAAATTTAACTGAAGAGCATGCCCCCCGTTGCCCCGTTCGCGGCGTGCGCGGGGTGCTTGCGCTTTCGAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATTGCGTCGCCCCGGGGCGGATATTGGCCTCCCGTGCTCTCGGGTGCGGTTGGCCCAAAAGCGAGTCCCCGGCAGCGGACGTCACGACAAGTGGTGGTTGAAAAGCCTTCTTATCCTGTCGTGCGGTCCTCCGTTGCCATCGGGCACTTTCTTGACCCTGACGCGCCGTTCCTGACGGCGCTTCGA

Click for details-----ITS1

Click for details-----ITS2

ATTGCGTCGCCCCGGGGCGGATATTGGCCTCCCGTGCTCTCGGGTGCGGTTGGCCCAAAAGCGAGTCCCCGGCAGCGGACGTCACGACAAGTGGTGGTTGAAAAGCCTTCTTATCCTGTCGTGCGGTCCTCCGTTGCCATCGGGCACTTTCTTGACCCTGACGCGCCGTTCCTGACGGCGCTTCGA

Taxonomic Information

Plant ID: NPO12310
Plant Latin Name: Viburnum Orientale
Taxonomy Genus: Viburnum
Taxonomy Family: Adoxaceae

Plant External Links:

NCBI TaxonomyDB: 432678
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

7 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

5 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC4671

Ingredient ID: NPC296386

Ingredient ID: NPC261831

Ingredient ID: NPC216630

Ingredient ID: NPC209970

Ingredient ID: NPC207554

Ingredient ID: NPC134330

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Fatty acid binding protein family	FABP5	Fatty acid binding protein epidermal	Q01469	CHEMBL3674
Therapeutic Target	Fatty acid binding protein family	FABP4	Fatty acid binding protein adipocyte	P15090	CHEMBL2083
Therapeutic Target	Nuclear hormone receptor subfamily 1	PPARA	Peroxisome proliferator-activated receptor alpha	Q07869	CHEMBL239
Therapeutic Target	Oxidoreductase	TDO2	Tryptophan 2,3-dioxygenase	P48775	CHEMBL2140
Therapeutic Target	Oxidoreductase	PTGS2	Cyclooxygenase-2	P35354	CHEMBL230
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	3

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00638196	Placebo vs. Linoleic Acid Controlled Assessment of Treatment Efficacy in MS	multiple sclerosis	Oleic Acid (NPC261831)	NP level
NCT01792310	A Phase 1/2A Study of LAM561 in Adult Patients With Advanced Solid Tumours	glioma	Oleic Acid (NPC261831)	NP level
NCT01661764	Fish Oil Supplementation, Nutrigenomics and Colorectal Cancer Prevention	colorectal adenoma	Oleic Acid (NPC261831)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	IDO1,LMNA,PPARA,FABP5,TDO2,FABP4,OR51E2
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	FABP5,OR51E2,IDO1,FABP5,TDO2
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	IDO1,LMNA,PTGS2,TDO2,OR51E2
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	IDO1,LMNA,FABP5,PTGS2,TDO2
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	PPARA,IDO1,PTGS2,TDO2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	IDO1,FABP5,PTGS2,TDO2
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	IDO1,LMNA,FABP5,OR51E2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	FABP4,IDO1,TDO2,PTGS2
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	IDO1,TDO2,PTGS2
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	IDO1,FABP5,TDO2
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	OR51E2,IDO1,FABP5
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	FABP4,OR51E2,FABP5
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	IDO1,OR51E2,LMNA
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	FABP5,FABP4,OR51E2
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	OR51E2,TDO2,FABP5
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	IDO1,FABP5,TDO2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	OR51E2,IDO1,FABP5
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	PPARA,PTGS2
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	PPARA FABP4
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	PTGS2,PPARA
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	PPARA,PTGS2
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	IDO1 NCT01661764
Malignant neoplasms of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	FABP4,PTGS2
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	IDO1,PTGS2
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA,PTGS2
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	IDO1,TDO2
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	IDO1,TDO2
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	FABP4,TDO2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	IDO1,TDO2
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	IDO1,TDO2
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	IDO1,PTGS2
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	OR51E2,IDO1
Ureteral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C92	IDO1
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	IDO1
Neuroendocrine carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C34	IDO1
Knee osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA01	PTGS2
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	PTGS2
B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A86	IDO1
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	PTGS2
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	IDO1
Inflammatory spondyloarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA92	PTGS2
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	PTGS2
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	PTGS2
Otitis media Disease Category: 10.Diseases of the ear or mastoid process Disease ICD-11 Code: AA80-AB0Z	PTGS2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	PTGS2
Joint pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME82	PTGS2
Hyperlipidemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	PPARA
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	PTGS2
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	PTGS2
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	PTGS2
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	PTGS2
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	IDO1
Inborn lipid metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52	PPARA
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	IDO1
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	PTGS2
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	IDO1
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	PPARA
Reactive arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA11	PTGS2
HIV-infected patients with tuberculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1B10-1B14	PTGS2
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	PPARA
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	IDO1
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	IDO1
Inherited coagulation factor deficiency Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B14	PTGS2
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	PTGS2
Spinal pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME84	PTGS2
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	PTGS2
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	IDO1
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	PPARA
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	IDO1
Urinary system disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GC2Z	PTGS2
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	PTGS2
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	IDO1
Dyslipidemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80-5C81	PPARA
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	IDO1
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	PTGS2
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	PTGS2
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	IDO1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	IDO1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NCT00638196
Glioma, malignant Disease Category: X.Extension Codes Disease ICD-11 Code: XH4RQ3	NCT01792310
Non-alcoholic steatohepatitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92.1	PTGS2
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	IDO1
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	IDO1
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	FABP5
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	IDO1
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	IDO1
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	OR51E2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	IDO1
Malignant neoplasms of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	FABP4
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	TDO2
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	PTGS2
Malaria, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F4Z	IDO1
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	IDO1
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	FABP5
Malignant neoplasm of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	FABP4
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	IDO1
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	IDO1

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Viburnum Orientale

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

7 All known Ingredients in Total

5 Ingredients with Acceptable Bioavailablity

5 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Adenocarcinoma of pancreas

Glioblastoma of brain

Solid tumour/cancer

Carcinosarcoma of uterus

Malignant neoplasms of biliary tract, distal bile duct

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Crohn disease

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Hepatoblastoma

Mesothelioma of pleura

Hepatocellular carcinoma of liver

Adenocarcinoma of prostate

Malignant neoplasms of thymus

Malignant neoplasms of adrenal gland

Hyper-lipoproteinaemia

Non-alcoholic fatty liver disease

Type 2 diabetes mellitus

Cardiovascular disease

Colorectal cancer

Malignant neoplasms of bladder

West Nile virus infection

Superficial ovarian endometriosis

Malignant neoplasms of oesophagus

Urothelial carcinoma of bladder

Systemic sclerosis

Malignant neoplasms of corpus uteri, unspecified

Invasive carcinoma of breast

Human immunodeficiency virus disease without mention of tuberculosis or malaria

Carpal tunnel syndrome

Ureteral cancer

Brain cancer

Neuroendocrine carcinoma

Knee osteoarthritis

Parkinsonism

B-cell lymphoma

Chronic pain

Head and neck cancer

Inflammatory spondyloarthritis

Pain, unspecified

Cerebral ischaemia

Otitis media

Asthma

Joint pain

Hyperlipidemia

Endometriosis

Alzheimer disease

Atopic eczema

Osteoarthritis

Ovarian cancer

Inborn lipid metabolism error

Melanoma

Myocardial infarction

Nasopharyngeal cancer

Gout

Reactive arthropathy

HIV-infected patients with tuberculosis

Acute diabete complication

Pancreatic cancer

Mature T-cell lymphoma

Inherited coagulation factor deficiency

Rheumatoid arthritis