• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Theobroma Speciosum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATTGTCACCCCCACACACATACGCGAGCTTGCCCCGGAGGTGTGCCACGGAGGGGGTAGAGAATGGCTTCCTGGATCACGGCNGGCCCAAAAGTGAGCCCTTGGTNNCAAAAGCGCTGTAGCAATTGGTGGTAATGCTCGTGAGAGTCCCCCGTTGTACGCGCCCATCATACGGTCTGGCCACCCCACAGTCCNTATCGCGTTGACCTGTCAACACTCACA
Taxonomic Information

Plant ID: NPO1219
Plant Latin Name: Theobroma Speciosum
Taxonomy Genus: Theobroma
Taxonomy Family: Malvaceae

Plant External Links:

NCBI TaxonomyDB: 108885
Plant-of-the-World-Online: 825614-1

Used in Medicines

Country/Region:
Bolivia

Traditional Medicine System:

Geographical Distribution

Brazil; Bolivia; Venezuela; Peru

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

24 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

13 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC73708

Ingredient ID: NPC53069

Ingredient ID: NPC32860

Ingredient ID: NPC300505

Ingredient ID: NPC289878

Ingredient ID: NPC257232

Ingredient ID: NPC241600

Ingredient ID: NPC237435

Ingredient ID: NPC228357

Ingredient ID: NPC228346

Ingredient ID: NPC225153

Ingredient ID: NPC22437

Ingredient ID: NPC21402

Ingredient ID: NPC209075

Ingredient ID: NPC205727

Ingredient ID: NPC202605

Ingredient ID: NPC173726

Ingredient ID: NPC171409

Ingredient ID: NPC170011

Ingredient ID: NPC16452

Ingredient ID: NPC13826

Ingredient ID: NPC122225

Ingredient ID: NPC120426

Ingredient ID: NPC119681