• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Albizia Julibrissin


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGGTGCCACGCAAAAAGAGCGACCCGAGAACCGGTTGGAACAAAACTCTGGCGGGGGAGGCCGAGGCCCACCCCCGACAACCAAACCCCGGCGCCCCAGGCGCCAAGGAAACGAAGCGAAGCAAGGCACTCGTGCCATTTGCATCAGAAA

Click for details-----ITS2

AACGTCGCCAGCGCCGGATCCTACGGGCGCGGCGGATGATGGCCTCCCGGGAGCCTCGCCTCCCGGCCGGCCGAAAAAGGGGCCCTACGTGACGGCCGCCACGATCCACGGTGGTTGAGTGAGCATTCGCTCGAGGCCAAGACGTGCGCGCGCCGTCCCACGGCGGGGGCCAGTCGGACGGGGCACAGCCCGCCCACTCGTA
Taxonomic Information

Plant ID: NPO12181
Plant Latin Name: Albizia Julibrissin
Taxonomy Genus: Albizia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 3813
Plant-of-the-World-Online: 473275-1

Used in Medicines

Country/Region:
South Korea; India

Traditional Medicine System:
Indian Folk


Medicinal Functions:

Analgesic; Anthelmintic; Carminative; Digestive; Diuretic; Oxytoxic; Plaster; Plaster; Sedative; Stimulant; Tonic; Vulnerary

Geographical Distribution

Turkey; Bangladesh; Nepal; Peru; Argentina; Turkmenistan; Iran; Russia; China; Iraq; Ukraine; United States; South Korea; Pakistan; Myanmar; South Africa; Cyprus; India; Uzbekistan; Japan; Taiwan; Tajikistan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

164 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


102 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

89 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99886

Ingredient ID: NPC94699

Ingredient ID: NPC90285

Ingredient ID: NPC89798

Ingredient ID: NPC87125

Ingredient ID: NPC85813

Ingredient ID: NPC84113

Ingredient ID: NPC83028

Ingredient ID: NPC81010

Ingredient ID: NPC79913

Ingredient ID: NPC76336

Ingredient ID: NPC75871

Ingredient ID: NPC74092

Ingredient ID: NPC72509

Ingredient ID: NPC71853

Ingredient ID: NPC71699

Ingredient ID: NPC71327

Ingredient ID: NPC70136

Ingredient ID: NPC65517

Ingredient ID: NPC61779

Ingredient ID: NPC61506

Ingredient ID: NPC60548

Ingredient ID: NPC60206

Ingredient ID: NPC59786

Ingredient ID: NPC57879

Ingredient ID: NPC56151

Ingredient ID: NPC52322

Ingredient ID: NPC51114

Ingredient ID: NPC50898

Ingredient ID: NPC47844

Ingredient ID: NPC4718

Ingredient ID: NPC46981

Ingredient ID: NPC45606

Ingredient ID: NPC45485

Ingredient ID: NPC44489

Ingredient ID: NPC43589

Ingredient ID: NPC43246

Ingredient ID: NPC43055

Ingredient ID: NPC42372

Ingredient ID: NPC38209

Ingredient ID: NPC37134

Ingredient ID: NPC36835

Ingredient ID: NPC36484

Ingredient ID: NPC34103

Ingredient ID: NPC32977

Ingredient ID: NPC327880

Ingredient ID: NPC326271

Ingredient ID: NPC321233

Ingredient ID: NPC320083

Ingredient ID: NPC319274

Ingredient ID: NPC315

Ingredient ID: NPC31279

Ingredient ID: NPC311987

Ingredient ID: NPC311178

Ingredient ID: NPC306988

Ingredient ID: NPC306647

Ingredient ID: NPC305205

Ingredient ID: NPC303740

Ingredient ID: NPC303621

Ingredient ID: NPC302876

Ingredient ID: NPC300655

Ingredient ID: NPC300017

Ingredient ID: NPC297058

Ingredient ID: NPC289475

Ingredient ID: NPC28280

Ingredient ID: NPC282370

Ingredient ID: NPC281387

Ingredient ID: NPC279121

Ingredient ID: NPC278434

Ingredient ID: NPC276222

Ingredient ID: NPC271527

Ingredient ID: NPC271141

Ingredient ID: NPC269919

Ingredient ID: NPC268862

Ingredient ID: NPC265699

Ingredient ID: NPC264288

Ingredient ID: NPC263528

Ingredient ID: NPC263222

Ingredient ID: NPC262291

Ingredient ID: NPC260491

Ingredient ID: NPC258171

Ingredient ID: NPC257451

Ingredient ID: NPC257190

Ingredient ID: NPC251306

Ingredient ID: NPC246162

Ingredient ID: NPC240476

Ingredient ID: NPC233443

Ingredient ID: NPC233223

Ingredient ID: NPC232881

Ingredient ID: NPC232375

Ingredient ID: NPC232237

Ingredient ID: NPC225710

Ingredient ID: NPC222951

Ingredient ID: NPC220838

Ingredient ID: NPC219913

Ingredient ID: NPC216964

Ingredient ID: NPC216630

Ingredient ID: NPC211035

Ingredient ID: NPC210729

Ingredient ID: NPC210332

Ingredient ID: NPC209970

Ingredient ID: NPC209705

Ingredient ID: NPC209560

Ingredient ID: NPC208463

Ingredient ID: NPC20791

Ingredient ID: NPC207824

Ingredient ID: NPC207738

Ingredient ID: NPC203719

Ingredient ID: NPC201562

Ingredient ID: NPC200788

Ingredient ID: NPC198440

Ingredient ID: NPC196874

Ingredient ID: NPC193812

Ingredient ID: NPC192638

Ingredient ID: NPC19174

Ingredient ID: NPC191460

Ingredient ID: NPC190626

Ingredient ID: NPC188501

Ingredient ID: NPC188433

Ingredient ID: NPC187509

Ingredient ID: NPC183950

Ingredient ID: NPC183816

Ingredient ID: NPC183657

Ingredient ID: NPC176326

Ingredient ID: NPC173637

Ingredient ID: NPC172365

Ingredient ID: NPC171139

Ingredient ID: NPC16947

Ingredient ID: NPC169207

Ingredient ID: NPC16737

Ingredient ID: NPC16525

Ingredient ID: NPC165159

Ingredient ID: NPC164958

Ingredient ID: NPC164349

Ingredient ID: NPC159312

Ingredient ID: NPC156654

Ingredient ID: NPC156353

Ingredient ID: NPC153572

Ingredient ID: NPC151199

Ingredient ID: NPC141765

Ingredient ID: NPC140840

Ingredient ID: NPC139576

Ingredient ID: NPC138299

Ingredient ID: NPC13755

Ingredient ID: NPC13190

Ingredient ID: NPC130849

Ingredient ID: NPC126825

Ingredient ID: NPC125793

Ingredient ID: NPC125564

Ingredient ID: NPC125062

Ingredient ID: NPC120464

Ingredient ID: NPC119039

Ingredient ID: NPC118636

Ingredient ID: NPC116775

Ingredient ID: NPC115323

Ingredient ID: NPC113961

Ingredient ID: NPC113877

Ingredient ID: NPC113620

Ingredient ID: NPC109875

Ingredient ID: NPC10915

Ingredient ID: NPC108441

Ingredient ID: NPC107482

Ingredient ID: NPC105800

Ingredient ID: NPC100612