• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Macaranga Tanarius


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GATCATTGTCGAAACCTGCCCTGCAGAACGACCCGCGAACACGTTTACAATATCAAGGGGGGCGGGGGGGCTTTTGCTCCCCCATCCACCAATGCTTATGGGACGGATGGCGGGCTTCGCCCAAACCATCCCCTCAGAAGCGAAATAACCAACCCCGGCGCAGGTAGCGCCAAGGAATATGAACTAAAAGAGAGCACGCTGCCACAGTCCCTGGAAACGGTGAGACTTGGGCATGCGTCATACTCTTTCAAAAATCAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO11884
Plant Latin Name: Macaranga Tanarius
Taxonomy Genus: Macaranga
Taxonomy Family: Euphorbiaceae

Plant External Links:

NCBI TaxonomyDB: 109849
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM

Geographical Distribution

India; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

92 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


28 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

44 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97345

Ingredient ID: NPC96294

Ingredient ID: NPC95447

Ingredient ID: NPC7883

Ingredient ID: NPC78399

Ingredient ID: NPC70946

Ingredient ID: NPC67396

Ingredient ID: NPC61522

Ingredient ID: NPC58085

Ingredient ID: NPC5622

Ingredient ID: NPC52374

Ingredient ID: NPC50102

Ingredient ID: NPC483763

Ingredient ID: NPC483762

Ingredient ID: NPC483761

Ingredient ID: NPC483760

Ingredient ID: NPC483759

Ingredient ID: NPC483758

Ingredient ID: NPC483757

Ingredient ID: NPC483756

Ingredient ID: NPC46160

Ingredient ID: NPC43918

Ingredient ID: NPC41930

Ingredient ID: NPC41794

Ingredient ID: NPC39072

Ingredient ID: NPC321779

Ingredient ID: NPC321399

Ingredient ID: NPC313148

Ingredient ID: NPC307063

Ingredient ID: NPC302324

Ingredient ID: NPC301377

Ingredient ID: NPC299436

Ingredient ID: NPC293549

Ingredient ID: NPC293319

Ingredient ID: NPC292925

Ingredient ID: NPC292419

Ingredient ID: NPC290791

Ingredient ID: NPC290598

Ingredient ID: NPC281131

Ingredient ID: NPC274618

Ingredient ID: NPC2745

Ingredient ID: NPC270213

Ingredient ID: NPC266605

Ingredient ID: NPC264145

Ingredient ID: NPC25701

Ingredient ID: NPC252990

Ingredient ID: NPC252044

Ingredient ID: NPC246732

Ingredient ID: NPC24125

Ingredient ID: NPC240937

Ingredient ID: NPC231714

Ingredient ID: NPC23111

Ingredient ID: NPC223834

Ingredient ID: NPC223730

Ingredient ID: NPC22150

Ingredient ID: NPC219934

Ingredient ID: NPC213896

Ingredient ID: NPC212885

Ingredient ID: NPC212142

Ingredient ID: NPC21210

Ingredient ID: NPC210459

Ingredient ID: NPC201814

Ingredient ID: NPC201800

Ingredient ID: NPC201562

Ingredient ID: NPC201093

Ingredient ID: NPC2003

Ingredient ID: NPC195561

Ingredient ID: NPC192811

Ingredient ID: NPC19213

Ingredient ID: NPC186463

Ingredient ID: NPC178134

Ingredient ID: NPC176740

Ingredient ID: NPC170828

Ingredient ID: NPC169468

Ingredient ID: NPC16895

Ingredient ID: NPC159362

Ingredient ID: NPC158784

Ingredient ID: NPC157792

Ingredient ID: NPC150385

Ingredient ID: NPC144054

Ingredient ID: NPC142754

Ingredient ID: NPC138122

Ingredient ID: NPC136486

Ingredient ID: NPC135855

Ingredient ID: NPC13143

Ingredient ID: NPC131364

Ingredient ID: NPC122504

Ingredient ID: NPC120621

Ingredient ID: NPC11536

Ingredient ID: NPC113828

Ingredient ID: NPC112585

Ingredient ID: NPC111520