• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Eleutherococcus Senticosus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTACCATACCGGGCGAGGGACGTGGGGTGCGCAAGTTCCCCAAGTCGCGAACCCATTGTCGGGGATCGCCCTCGGGCGGTCCTCGACTGAACAACGTCACCCCGGCGCGGAATGCGCCAAGGAAATCAAACTGAACTGAACGCGTCCCACCCGTTCGCGGGCTGTGGGGGCGTCTTTTTAAAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCAGATGAAGAACGTAGCGAAATGCCGGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGTCGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCAACCCTGCACTCCCTCATGGGAGTCATGACTGAGGGGCGGATTGACTGGCCTCCCGTGTCTCACCGTGCGGTTGGCCCAAATGTGAGTCCTTGGCGACGGACGTCACGACAAGTGGTGGTTGTATCAAAAGCCCTCTTCTCCTGTCGTGCGGTGGCCCGTCGCCAGCAAAAGCTCATGTGACCCTGTTGTGCCGTCCTCGACGAGCTAACTCCGA

Click for details-----ITS1

TCGAAACCTGCACAGCAGAACGACCCGCGAACACGTTACCATACCGTTCGAGGGACGTGGTGGTGCGCAAGTTCCCCAAGTCGCGAACCCATTGTCGGGGATTGCCCTCGGTCGGTCCTCGACTCGAACAACGTCACCCCGGCGCGGAATGCGCCAAGGAAATCAAACTGAACTGAACGCGTCCCACCGTTCGCGGGCTGTGGGGGCGTCTTTCTAAAACACAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCAACCCTGCACTCCCTCATGGGAGTCATGACTGAGGGGCGGATTGACTGGCCTCCCGTGTCTCACCGTGCGGTTGGCCCAAATGTGAGTCCTTGGCGACGGACGTCACGACAAGTGGTGGTTGTATCAAAAGCCCTCTTCTCCTGTCGTGCGGTGGCCCGTCGCCAGCAAAAGCTCATGTGACCCTGTTGTGCCGTCCTCGACGAGCTAACTCCGA
Taxonomic Information

Plant ID: NPO11872
Plant Latin Name: Eleutherococcus Senticosus
Taxonomy Genus: Eleutherococcus
Taxonomy Family: Araliaceae

Plant External Links:

NCBI TaxonomyDB: 82096
Plant-of-the-World-Online: 90431-1

Used in Medicines

Country/Region:
Russia

Traditional Medicine System:


Medicinal Functions:

Adaptogen; Antiinflammatory; Hypoglycaemic; Tonic; Vasodilator

Geographical Distribution

Japan; China; Russia; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

141 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


75 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

64 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC95392

Ingredient ID: NPC93201

Ingredient ID: NPC93033

Ingredient ID: NPC90725

Ingredient ID: NPC87466

Ingredient ID: NPC85813

Ingredient ID: NPC84398

Ingredient ID: NPC83798

Ingredient ID: NPC83535

Ingredient ID: NPC81010

Ingredient ID: NPC78612

Ingredient ID: NPC78479

Ingredient ID: NPC76972

Ingredient ID: NPC70744

Ingredient ID: NPC67857

Ingredient ID: NPC66700

Ingredient ID: NPC5982

Ingredient ID: NPC59474

Ingredient ID: NPC55830

Ingredient ID: NPC55715

Ingredient ID: NPC55063

Ingredient ID: NPC54395

Ingredient ID: NPC5326

Ingredient ID: NPC52230

Ingredient ID: NPC52086

Ingredient ID: NPC49074

Ingredient ID: NPC488688

Ingredient ID: NPC488687

Ingredient ID: NPC488686

Ingredient ID: NPC488685

Ingredient ID: NPC488684

Ingredient ID: NPC488683

Ingredient ID: NPC488682

Ingredient ID: NPC35877

Ingredient ID: NPC35519

Ingredient ID: NPC34902

Ingredient ID: NPC34103

Ingredient ID: NPC33611

Ingredient ID: NPC33320

Ingredient ID: NPC32977

Ingredient ID: NPC314434

Ingredient ID: NPC309907

Ingredient ID: NPC306470

Ingredient ID: NPC306195

Ingredient ID: NPC304964

Ingredient ID: NPC302857

Ingredient ID: NPC29883

Ingredient ID: NPC294902

Ingredient ID: NPC293377

Ingredient ID: NPC293305

Ingredient ID: NPC290319

Ingredient ID: NPC28913

Ingredient ID: NPC288254

Ingredient ID: NPC279633

Ingredient ID: NPC279610

Ingredient ID: NPC279481

Ingredient ID: NPC278124

Ingredient ID: NPC277493

Ingredient ID: NPC27730

Ingredient ID: NPC275769

Ingredient ID: NPC273730

Ingredient ID: NPC272801

Ingredient ID: NPC272195

Ingredient ID: NPC271087

Ingredient ID: NPC27075

Ingredient ID: NPC268221

Ingredient ID: NPC267635

Ingredient ID: NPC266061

Ingredient ID: NPC264711

Ingredient ID: NPC253905

Ingredient ID: NPC249045

Ingredient ID: NPC247871

Ingredient ID: NPC24747

Ingredient ID: NPC243509

Ingredient ID: NPC242580

Ingredient ID: NPC236579

Ingredient ID: NPC234536

Ingredient ID: NPC230301

Ingredient ID: NPC229230

Ingredient ID: NPC227058

Ingredient ID: NPC223697

Ingredient ID: NPC220089

Ingredient ID: NPC216630

Ingredient ID: NPC214458

Ingredient ID: NPC214374

Ingredient ID: NPC210460

Ingredient ID: NPC209970

Ingredient ID: NPC205380

Ingredient ID: NPC204673

Ingredient ID: NPC19834

Ingredient ID: NPC196924

Ingredient ID: NPC19530

Ingredient ID: NPC194857

Ingredient ID: NPC192107

Ingredient ID: NPC184049

Ingredient ID: NPC178134

Ingredient ID: NPC177002

Ingredient ID: NPC174720

Ingredient ID: NPC17252

Ingredient ID: NPC171928

Ingredient ID: NPC171736

Ingredient ID: NPC16830

Ingredient ID: NPC167976

Ingredient ID: NPC165204

Ingredient ID: NPC165159

Ingredient ID: NPC164700

Ingredient ID: NPC162534

Ingredient ID: NPC161193

Ingredient ID: NPC157781

Ingredient ID: NPC156654

Ingredient ID: NPC155977

Ingredient ID: NPC155767

Ingredient ID: NPC154186

Ingredient ID: NPC153745

Ingredient ID: NPC153572

Ingredient ID: NPC149203

Ingredient ID: NPC143639

Ingredient ID: NPC142753

Ingredient ID: NPC141765

Ingredient ID: NPC141273

Ingredient ID: NPC138582

Ingredient ID: NPC138347

Ingredient ID: NPC136165

Ingredient ID: NPC1321

Ingredient ID: NPC129489

Ingredient ID: NPC126759

Ingredient ID: NPC125275

Ingredient ID: NPC123965

Ingredient ID: NPC117237

Ingredient ID: NPC117057

Ingredient ID: NPC115776

Ingredient ID: NPC114287

Ingredient ID: NPC111897

Ingredient ID: NPC111888

Ingredient ID: NPC111395

Ingredient ID: NPC110899

Ingredient ID: NPC110528

Ingredient ID: NPC1075

Ingredient ID: NPC107482

Ingredient ID: NPC100223