• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Illicium Difengpi


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATGACCCACTAGGCTAACCGGTGAACTTGTCACATCATTCTTGGGGGTGATGGGAATGTCCTTCGGGGCCCTAGATACCCTCCTCCCCCTCCCTTGGTTCTTGCTTCTTTTATCGATGGTCCCTTGAGGAGTAGAGAAACATGGGGGGTGGGAACAACCGACACCGGCGCGGCATGCGTCAAGTAATCACGAACGGAATAAGGCACCTCCTCTGCAGGGGTGGTGCTGTAGACCCGAATAAAATCAGAGATGACTCTCGGCAACGGATATCTAGGCTCTTGCCACGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCAAGTTTTTGAACGCAAGTTGCACCCGAGGCCACCAGGCCAAGGGCACGCCTGCCTGGGCGTCACGCTTTGCGTCGCTCCCCCACCTCCTTGCCCATACGGGCTTTGTGGTGTTAAGGGGAAGCGGAGATTGGCTGCCCGTGCCATGGTTGCGTGGCCAGCCGAAAAGTGGGCCTCTGGCGTGTTGCGACACGACGAGTGGTGGTCAAATACCCTTCTCATCGCATGGGACGTCGAGTCGCTTTGCTAGTGGCACATGAACTCTTGGGGCCATTTCGCGGCAACCTGCA

Click for details-----ITS1

TCGATGACCCACTAGGCTAACCGGTGAACTTGTCACATCATTCTTGGGGGTGATGGGAATGTCCTTCGGGGCCCTAGATACCCTCCTCCCCCTCCCTTGGTTCTTGCTTCTTTTATCGATGGTCCCTTGAGGAGTAGAGAAACATGGGGGGTGGGAACAACCGACACCGGCGCGGCATGCGTCAAGTAATCACGAACGGAATAAGGCACCTCCTCTGCAGGGGTGGTGCTGTAGACCCGAATAAAATCAGAGA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO11871
Plant Latin Name: Illicium Difengpi
Taxonomy Genus: Illicium
Taxonomy Family: Schisandraceae

Plant External Links:

NCBI TaxonomyDB: 124772
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

120 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


105 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

68 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95675

Ingredient ID: NPC93843

Ingredient ID: NPC91574

Ingredient ID: NPC88566

Ingredient ID: NPC82648

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC71853

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC68889

Ingredient ID: NPC67037

Ingredient ID: NPC63697

Ingredient ID: NPC61769

Ingredient ID: NPC60556

Ingredient ID: NPC60555

Ingredient ID: NPC57877

Ingredient ID: NPC54264

Ingredient ID: NPC5423

Ingredient ID: NPC51189

Ingredient ID: NPC49026

Ingredient ID: NPC469625

Ingredient ID: NPC469622

Ingredient ID: NPC469621

Ingredient ID: NPC469614

Ingredient ID: NPC469613

Ingredient ID: NPC469612

Ingredient ID: NPC45727

Ingredient ID: NPC44751

Ingredient ID: NPC43822

Ingredient ID: NPC43114

Ingredient ID: NPC40249

Ingredient ID: NPC3649

Ingredient ID: NPC36408

Ingredient ID: NPC35932

Ingredient ID: NPC34764

Ingredient ID: NPC31279

Ingredient ID: NPC310905

Ingredient ID: NPC309182

Ingredient ID: NPC301195

Ingredient ID: NPC301043

Ingredient ID: NPC300649

Ingredient ID: NPC30043

Ingredient ID: NPC298080

Ingredient ID: NPC297358

Ingredient ID: NPC292792

Ingredient ID: NPC291100

Ingredient ID: NPC290613

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC29

Ingredient ID: NPC289366

Ingredient ID: NPC288411

Ingredient ID: NPC287331

Ingredient ID: NPC277728

Ingredient ID: NPC274613

Ingredient ID: NPC270072

Ingredient ID: NPC26906

Ingredient ID: NPC268564

Ingredient ID: NPC264317

Ingredient ID: NPC257124

Ingredient ID: NPC252067

Ingredient ID: NPC249357

Ingredient ID: NPC244858

Ingredient ID: NPC239039

Ingredient ID: NPC233267

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC230301

Ingredient ID: NPC228785

Ingredient ID: NPC22484

Ingredient ID: NPC220322

Ingredient ID: NPC218918

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC209275

Ingredient ID: NPC196343

Ingredient ID: NPC195717

Ingredient ID: NPC192638

Ingredient ID: NPC190810

Ingredient ID: NPC18842

Ingredient ID: NPC186098

Ingredient ID: NPC182840

Ingredient ID: NPC180871

Ingredient ID: NPC178638

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC175987

Ingredient ID: NPC175313

Ingredient ID: NPC173996

Ingredient ID: NPC17112

Ingredient ID: NPC166000

Ingredient ID: NPC1656

Ingredient ID: NPC164958

Ingredient ID: NPC16485

Ingredient ID: NPC163984

Ingredient ID: NPC16287

Ingredient ID: NPC160550

Ingredient ID: NPC157328

Ingredient ID: NPC156353

Ingredient ID: NPC150643

Ingredient ID: NPC144403

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139557

Ingredient ID: NPC139546

Ingredient ID: NPC138113

Ingredient ID: NPC131981

Ingredient ID: NPC131769

Ingredient ID: NPC124885

Ingredient ID: NPC123965

Ingredient ID: NPC12269

Ingredient ID: NPC11651

Ingredient ID: NPC114239

Ingredient ID: NPC109813

Ingredient ID: NPC105246

Ingredient ID: NPC105209

Ingredient ID: NPC100773