• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Magnolia Obovata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CGAGAAGTCCACCGACCAGCGAACCGGTGACCCTAACAAGACGGGCGTGGCTCGAGGAGAGCTGACATGCTCTTCCGGCACGCGACGAACCACCCCCGGCGGTATGTGCGCCAAGGAATTGAAATGGAATGAGCGCGGCTCTCTCCGGGATGCTGGCACGCGTTTGGAACTTACACGACTCTCGGCAACGGATATCTCGGCTCTCACATCAATGAAGAACGTAGCGAAATGTGATACTTGGTGTGAATGGCAGAATCCCGTCAACTATCGAGTCTTTAAACACAAGTTGTCCCCGAGGCCACCTGGCCGAGGGCATGCCTGCCTGGGTGTCATGCATTGTGCTGCCTCATCCGGCACTCGCCTCATCCAGCGACGGCGTCACGGGGCGGAGACTGGCTGCCCGTGCACCCTGCGCGCGCGGCTGGCTGAAAAACAAGCGCTCCCCCGTAGGGGCGCGGGTGGGGTGATAGGTGGTTTGAGAGGCGGCTGCCTCATCGGAGACAGGACGCTGCACCCATCGTCCCGCTCCCGGGGGTAAAGTGACACCCAACTCGACTGCCCCGGGCGG

Click for details-----ITS1

CGAGAAGTCCACCGACCAGCGAACCGGTGACCCTAACAAGACGGGCGTGGCTCGAGGAGAGCTGACATGCTCTTCCGGCACGCGACGAACCACCCCCGGCGGTATGTGCGCCAAGGAATTGAAATGGAATGAGCGCGGCTCTCTCCGGGATGCTGGCACGCGTTTGGAACTTACA

Click for details-----ITS2

ATTGTGCTGCCTCATCCGGCACTCGCCTCATCCAGCGACGGCGTCACGGGGCGGAGACTGGCTGCCCGTGCACCCTGCGCGCGCGGCTGGCTGAAAAACAAGCGCTCCCCCGTAGGGGCGCGGGTGGGGTGATAGGTGGTTTGAGAGGCGGCTGCCTCATCGGAGACAGGACGCTGCACCCATCGTCCCGCTCCCGGGGGTAAAGTGACACCCAACTCGACTGCCCCGGGCGG
Taxonomic Information

Plant ID: NPO11791
Plant Latin Name: Magnolia Obovata
Taxonomy Genus: Magnolia
Taxonomy Family: Magnoliaceae

Plant External Links:

NCBI TaxonomyDB: 349509
Plant-of-the-World-Online: 554784-1

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM

Geographical Distribution

Japan; South Korea; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

193 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


159 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

86 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9880

Ingredient ID: NPC96630

Ingredient ID: NPC96218

Ingredient ID: NPC95675

Ingredient ID: NPC93201

Ingredient ID: NPC90701

Ingredient ID: NPC89069

Ingredient ID: NPC88759

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC86947

Ingredient ID: NPC85270

Ingredient ID: NPC85130

Ingredient ID: NPC83928

Ingredient ID: NPC81247

Ingredient ID: NPC81246

Ingredient ID: NPC81218

Ingredient ID: NPC78551

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC75097

Ingredient ID: NPC7491

Ingredient ID: NPC71703

Ingredient ID: NPC66913

Ingredient ID: NPC66577

Ingredient ID: NPC63027

Ingredient ID: NPC62086

Ingredient ID: NPC61769

Ingredient ID: NPC60556

Ingredient ID: NPC59581

Ingredient ID: NPC54264

Ingredient ID: NPC53720

Ingredient ID: NPC52422

Ingredient ID: NPC52370

Ingredient ID: NPC51189

Ingredient ID: NPC50450

Ingredient ID: NPC49074

Ingredient ID: NPC4575

Ingredient ID: NPC44751

Ingredient ID: NPC43114

Ingredient ID: NPC428

Ingredient ID: NPC41080

Ingredient ID: NPC40249

Ingredient ID: NPC39333

Ingredient ID: NPC37439

Ingredient ID: NPC37438

Ingredient ID: NPC36490

Ingredient ID: NPC36108

Ingredient ID: NPC36002

Ingredient ID: NPC35627

Ingredient ID: NPC35344

Ingredient ID: NPC34103

Ingredient ID: NPC328408

Ingredient ID: NPC310478

Ingredient ID: NPC309182

Ingredient ID: NPC308218

Ingredient ID: NPC307011

Ingredient ID: NPC306902

Ingredient ID: NPC300649

Ingredient ID: NPC299964

Ingredient ID: NPC299687

Ingredient ID: NPC297844

Ingredient ID: NPC297670

Ingredient ID: NPC297527

Ingredient ID: NPC296337

Ingredient ID: NPC291647

Ingredient ID: NPC290189

Ingredient ID: NPC288411

Ingredient ID: NPC28779

Ingredient ID: NPC286774

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC280320

Ingredient ID: NPC278525

Ingredient ID: NPC27410

Ingredient ID: NPC270386

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC264779

Ingredient ID: NPC26244

Ingredient ID: NPC259976

Ingredient ID: NPC256989

Ingredient ID: NPC252230

Ingredient ID: NPC251735

Ingredient ID: NPC24957

Ingredient ID: NPC248520

Ingredient ID: NPC248047

Ingredient ID: NPC243728

Ingredient ID: NPC242582

Ingredient ID: NPC241055

Ingredient ID: NPC239406

Ingredient ID: NPC233533

Ingredient ID: NPC232924

Ingredient ID: NPC231738

Ingredient ID: NPC230301

Ingredient ID: NPC228988

Ingredient ID: NPC227670

Ingredient ID: NPC226803

Ingredient ID: NPC226250

Ingredient ID: NPC22481

Ingredient ID: NPC223951

Ingredient ID: NPC222001

Ingredient ID: NPC221134

Ingredient ID: NPC218988

Ingredient ID: NPC218918

Ingredient ID: NPC216630

Ingredient ID: NPC216216

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC214251

Ingredient ID: NPC213526

Ingredient ID: NPC211722

Ingredient ID: NPC211608

Ingredient ID: NPC211342

Ingredient ID: NPC210831

Ingredient ID: NPC210288

Ingredient ID: NPC209275

Ingredient ID: NPC209011

Ingredient ID: NPC208764

Ingredient ID: NPC201636

Ingredient ID: NPC198865

Ingredient ID: NPC196490

Ingredient ID: NPC194677

Ingredient ID: NPC193180

Ingredient ID: NPC190036

Ingredient ID: NPC189470

Ingredient ID: NPC189036

Ingredient ID: NPC186944

Ingredient ID: NPC185072

Ingredient ID: NPC184615

Ingredient ID: NPC180684

Ingredient ID: NPC179826

Ingredient ID: NPC179825

Ingredient ID: NPC179024

Ingredient ID: NPC178223

Ingredient ID: NPC177465

Ingredient ID: NPC176740

Ingredient ID: NPC175987

Ingredient ID: NPC175313

Ingredient ID: NPC173996

Ingredient ID: NPC170960

Ingredient ID: NPC170503

Ingredient ID: NPC168829

Ingredient ID: NPC168409

Ingredient ID: NPC168255

Ingredient ID: NPC166963

Ingredient ID: NPC166894

Ingredient ID: NPC166362

Ingredient ID: NPC166014

Ingredient ID: NPC1656

Ingredient ID: NPC165159

Ingredient ID: NPC16157

Ingredient ID: NPC158376

Ingredient ID: NPC154920

Ingredient ID: NPC154186

Ingredient ID: NPC153572

Ingredient ID: NPC149700

Ingredient ID: NPC147390

Ingredient ID: NPC143956

Ingredient ID: NPC142632

Ingredient ID: NPC142569

Ingredient ID: NPC141777

Ingredient ID: NPC141765

Ingredient ID: NPC141003

Ingredient ID: NPC13991

Ingredient ID: NPC138466

Ingredient ID: NPC137949

Ingredient ID: NPC13789

Ingredient ID: NPC137153

Ingredient ID: NPC132097

Ingredient ID: NPC131981

Ingredient ID: NPC12987

Ingredient ID: NPC128457

Ingredient ID: NPC127122

Ingredient ID: NPC126519

Ingredient ID: NPC125191

Ingredient ID: NPC122792

Ingredient ID: NPC121081

Ingredient ID: NPC120926

Ingredient ID: NPC12053

Ingredient ID: NPC117862

Ingredient ID: NPC116628

Ingredient ID: NPC115119

Ingredient ID: NPC114526

Ingredient ID: NPC114239

Ingredient ID: NPC113650

Ingredient ID: NPC11358

Ingredient ID: NPC112355

Ingredient ID: NPC109813

Ingredient ID: NPC106250

Ingredient ID: NPC105004

Ingredient ID: NPC101285

Ingredient ID: NPC100980