CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Adoxa Moschatellina

Example Image

PLANiTS DNA barcode

Click for details-----ITS

GTCGAAACCTGCATAGCAGAATGACCCGTGAACTTGTTTTTTNTCTCGTGGCTCGTCGGACTAGGCATGCAAGTGCCTCGATCGACAAGCTTCGGTCAGGGCGCCATCGGTGTCATGACCAAACAACGAACCCCGGSACGGTCTGTGCCAAGGAAATTTATATAAAGAGCGTGTCTATTGTTGCCCCGTTCGCGGTGGCACGCTAGGCATGCGCCTTTGAAACACTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTWGCGAAATGCGATATTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAAGGGCACGTCTGCCTGGGCGTCACACATTGCCGTCGCCCCCATTCCAACTCCCTTTGYTTGGGAGTTTGTTGTAGGGGCGGAAATTGGCCTCCCGTGCTCTCTGGTGCGGTTGGCCCAAATGAGAGTACCCGACAACGTACGTCACAACAAGTGGTGGTTGAAAAGCCGTATATCATGTTGTGCACCAGTCCGTTGTCACGGGCACTGACTTGACCCTAAAGCGTCGTCTTTGATGTCGCTCCGACT

Click for details-----ITS1

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO11688
Plant Latin Name: Adoxa Moschatellina
Taxonomy Genus: Adoxa
Taxonomy Family: Adoxaceae

Plant External Links:

NCBI TaxonomyDB: 4208
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

3 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

2 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

2 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC62840

Ingredient ID: NPC293861

Ingredient ID: NPC270908

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Phosphodiesterase 4	PDE4D	Phosphodiesterase 4D	Q08499	CHEMBL288

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	PDE4D
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	PDE4D
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	PDE4D
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	PDE4D
Tonus and reflex abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB47	PDE4D
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	PDE4D
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	PDE4D
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	PDE4D
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	PDE4D
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	PDE4D
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	PDE4D
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	PDE4D
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	PDE4D
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	PDE4D
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	PDE4D
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	PDE4D
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	PDE4D

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Adoxa Moschatellina

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

3 All known Ingredients in Total

2 Ingredients with Acceptable Bioavailablity

2 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Rheumatoid arthritis

Mood disorder

Parkinsonism

Chronic obstructive pulmonary disease

Tonus and reflex abnormality

Mild neurocognitive disorder

Atopic eczema

Alzheimer disease

Asthma

Crohn disease

Choreiform disorder

Psoriasis

Pheochromocytoma

Adenocarcinoma of pancreas

Cytomegaloviral disease

Carpal tunnel syndrome

Malignant neoplasms of adrenal gland

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities