• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Juncus Effusus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AGGGTGACCTGCGGAAGGATCATTGTCGAGACCGGAATAGGATGACCCGCGCACAGTGATGGAACTCTCCGGGGCGGTGGTACTGCCTCGGCCCCGTGGCGCCTCCCTGCCTGCAGGTAGGAGGGCTCCGCGATTAAAACCCGGCGCGAAATTGACGCCAAGGTACACTGGAAAACAGCAGGCTTCGGACCGCGGCCGTGCCGTGCGAACGTCGCCTGAACAAATGATGGAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACGTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCATTCGGCTGAGGGCACGCCTGCCTGGGCGTCAGTTGCCCACTAACGCTCCTTGCCCATCTTTTACGTGGCGGGATGCGGAGCATGGCCATCCTTGCCCTCGGGCTCGGCGGGCCGAAGCATGTGGCTTGCCGATTGGGGCCGGCAGTGGCGAGTGGTGGATTGCTCACGCGAGCCGTACGTCGCCCGTCGTGCCCCCGAGCGGGAAGCCTCGTGTCACCCCGGACGCACGGATGCCGAACGGCATT

Click for details-----ITS1

TCGAGACCGGAATAGGATGACCCGCGCACTGTGATGGAACTCTCCGGGGCGGTGGTACTGCCTCGGCCCCGTGGCGCCTCCCTGCCTGCAGGTAGGAGGGCTCCGCGATTAAAACCCGGCGCGAAATTGACGCCAAGGTACACTGGCAAACAGCAGGCTTCGGACCGCGGCCGTGCCGTGTGAACGTCGCCTGAACAAATGTTGGAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO1150
Plant Latin Name: Juncus Effusus
Taxonomy Genus: Juncus
Taxonomy Family: Juncaceae

Plant External Links:

NCBI TaxonomyDB: 13579
Plant-of-the-World-Online: 442917-1

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
TCM


Medicinal Functions:

Antiphlogistic; Depurative; Diuretic; Febrifuge; Lenitive; Lithontripic; Pectoral; Sedative

Geographical Distribution

Canada; Afghanistan; Madagascar; Italy; Peru; Costa Rica; Cambodia; France; Ethiopia; Netherlands; Ireland; Bolivia; Norway; Ecuador; Australia; Iran; Algeria; El Salvador; Iceland; Venezuela; Guatemala; Zimbabwe; China; Belgium; Germany; Haiti; Iraq; Tanzania; Spain; Ukraine; Georgia; Uganda; Denmark; Poland; Finland; Turkey; Mauritius; Morocco; Sweden; Belarus; Kenya; Switzerland; New Zealand; Russia; Bulgaria; United States; Romania; Albania; Honduras; Portugal; Mexico; Tunisia; South Africa; India; United Kingdom; Austria; Rwanda; Colombia; Greece; Burundi; Hungary; Taiwan; Cyprus

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

62 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


34 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

26 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98163

Ingredient ID: NPC95716

Ingredient ID: NPC93542

Ingredient ID: NPC92985

Ingredient ID: NPC90371

Ingredient ID: NPC86412

Ingredient ID: NPC84019

Ingredient ID: NPC72670

Ingredient ID: NPC71413

Ingredient ID: NPC67956

Ingredient ID: NPC52063

Ingredient ID: NPC483363

Ingredient ID: NPC483362

Ingredient ID: NPC483361

Ingredient ID: NPC483360

Ingredient ID: NPC483359

Ingredient ID: NPC46940

Ingredient ID: NPC45965

Ingredient ID: NPC41233

Ingredient ID: NPC33294

Ingredient ID: NPC31152

Ingredient ID: NPC310099

Ingredient ID: NPC309367

Ingredient ID: NPC309203

Ingredient ID: NPC29980

Ingredient ID: NPC299625

Ingredient ID: NPC289758

Ingredient ID: NPC288983

Ingredient ID: NPC286815

Ingredient ID: NPC286295

Ingredient ID: NPC283274

Ingredient ID: NPC282633

Ingredient ID: NPC280246

Ingredient ID: NPC271322

Ingredient ID: NPC270088

Ingredient ID: NPC267317

Ingredient ID: NPC261021

Ingredient ID: NPC258501

Ingredient ID: NPC255253

Ingredient ID: NPC247681

Ingredient ID: NPC233533

Ingredient ID: NPC232615

Ingredient ID: NPC219913

Ingredient ID: NPC209054

Ingredient ID: NPC196434

Ingredient ID: NPC182933

Ingredient ID: NPC180058

Ingredient ID: NPC176017

Ingredient ID: NPC168624

Ingredient ID: NPC161480

Ingredient ID: NPC160054

Ingredient ID: NPC152451

Ingredient ID: NPC145879

Ingredient ID: NPC145151

Ingredient ID: NPC138993

Ingredient ID: NPC136699

Ingredient ID: NPC134700

Ingredient ID: NPC134546

Ingredient ID: NPC130730

Ingredient ID: NPC11311

Ingredient ID: NPC107102

Ingredient ID: NPC103497