• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Chelidonium Majus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCACAGCAGAGCGACCAGCGAACACGTGAATCCAAGTTCTTGGGACAGGCGAGTGGGAGTGATCCCCCCGTCTTTCCCTTGCCGTCTCGAGTGCTTCGGCATTTTCGAGATGGATAACAAACCCCACGGCGCGGACTGCGCCAAGGAAACAAACAAAGGAAATAGCGTGTGGCCCATCCGTCCCCGAATGCGGCAGGCGGCGCAGCGCAATCCGACCTTCGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCTAGGCCATCCGGCTGAGGGCACGCCTGCCTGGGCGTCACGCACTGAGTCGCCCCTTCTTCTCTGAGGAGAGATGGAGCGGAGATTGGCCCCCCGTGCTTCCGAGTGCGGTCGGCCTAAAACTTGGCCCTTGGAGGCCGGCGTCACGATCCGTGGTGGTTGGCATCAATTGTCTTATCCGGAATCCGTGGTCGTCGTTCCTCCTTTTGGACCACAAGGAACCCTCGAGAGGTTTAGGCCTCCACTCT

Click for details-----ITS1

TCGAAACCTGCACAGCAGAGCGACCAGCGAACACGTGAATCCAAGTTCTTGGGACAGGCGAGTGGGAGTGATCCCCCCGTCTTTCCCTTGCCGTCTCGAGTGCTTCGGCATTTTCGAGATGGATAACAAACCCCACGGCGCGGACTGCGCCAAGGAAACAAACAAAGGAAATAGCGTGTGGCCCATCCGTCTTCGGACGTGCTGGGTTGCGTCGTGAAATCCGATCTTCGAA

Click for details-----ITS2

ACTGAGTCGCCCCTTCTTCTCCGAGGAGAGATGGAGCGGAGATTGGCCCCCCGTGCTTCCGAGTGCGGTCGGCCTAAAACTTGGCCCTTGGAGGCCGGCGTCACGATCCGTGGTGGTTGGCATCAATTGTCTTATCCGGAATCCGTGGTCGTCGTTCCTCCTTTTGGACCACAAGGAACCCTCGAGAGGTTTTAGGCCTCCACTCT
Taxonomic Information

Plant ID: NPO11457
Plant Latin Name: Chelidonium Majus
Taxonomy Genus: Chelidonium
Taxonomy Family: Papaveraceae

Plant External Links:

NCBI TaxonomyDB: 71251
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Albania; Italy; Portugal; Lithuania; Sweden; China; South Korea; Russia; Spain; Bulgaria

Traditional Medicine System:
TCM


Medicinal Functions:

Acrid; Alterative; Anodyne; Antispasmodic; Cancer; Cholagogue; Diaphoretic; Diuretic; Hydrogogue; Narcotic; Ophthalmic; Purgative; Stomachic; Warts

Geographical Distribution

Turkey; Albania; Italy; Portugal; Lithuania; Sweden; China; South Korea; Russia; Spain; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

114 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


81 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

58 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94930

Ingredient ID: NPC93730

Ingredient ID: NPC93593

Ingredient ID: NPC89402

Ingredient ID: NPC86469

Ingredient ID: NPC81010

Ingredient ID: NPC77662

Ingredient ID: NPC77661

Ingredient ID: NPC72722

Ingredient ID: NPC70744

Ingredient ID: NPC67978

Ingredient ID: NPC53069

Ingredient ID: NPC51850

Ingredient ID: NPC50934

Ingredient ID: NPC46451

Ingredient ID: NPC41178

Ingredient ID: NPC3357

Ingredient ID: NPC32977

Ingredient ID: NPC324960

Ingredient ID: NPC321650

Ingredient ID: NPC32141

Ingredient ID: NPC316870

Ingredient ID: NPC315274

Ingredient ID: NPC314828

Ingredient ID: NPC313955

Ingredient ID: NPC312800

Ingredient ID: NPC308267

Ingredient ID: NPC307065

Ingredient ID: NPC306207

Ingredient ID: NPC303581

Ingredient ID: NPC29883

Ingredient ID: NPC294902

Ingredient ID: NPC294815

Ingredient ID: NPC294790

Ingredient ID: NPC293714

Ingredient ID: NPC293378

Ingredient ID: NPC287301

Ingredient ID: NPC285117

Ingredient ID: NPC276911

Ingredient ID: NPC275132

Ingredient ID: NPC275011

Ingredient ID: NPC274415

Ingredient ID: NPC26974

Ingredient ID: NPC268214

Ingredient ID: NPC265885

Ingredient ID: NPC26079

Ingredient ID: NPC259539

Ingredient ID: NPC257362

Ingredient ID: NPC251065

Ingredient ID: NPC249281

Ingredient ID: NPC236709

Ingredient ID: NPC23614

Ingredient ID: NPC235260

Ingredient ID: NPC234392

Ingredient ID: NPC232604

Ingredient ID: NPC23080

Ingredient ID: NPC228980

Ingredient ID: NPC226087

Ingredient ID: NPC225434

Ingredient ID: NPC218266

Ingredient ID: NPC216459

Ingredient ID: NPC211913

Ingredient ID: NPC211105

Ingredient ID: NPC206442

Ingredient ID: NPC204820

Ingredient ID: NPC196854

Ingredient ID: NPC194402

Ingredient ID: NPC192402

Ingredient ID: NPC192040

Ingredient ID: NPC19044

Ingredient ID: NPC183993

Ingredient ID: NPC183485

Ingredient ID: NPC183367

Ingredient ID: NPC181465

Ingredient ID: NPC179950

Ingredient ID: NPC179704

Ingredient ID: NPC176740

Ingredient ID: NPC174373

Ingredient ID: NPC173637

Ingredient ID: NPC173582

Ingredient ID: NPC171426

Ingredient ID: NPC171409

Ingredient ID: NPC16483

Ingredient ID: NPC163969

Ingredient ID: NPC162653

Ingredient ID: NPC15970

Ingredient ID: NPC159377

Ingredient ID: NPC157215

Ingredient ID: NPC154594

Ingredient ID: NPC154592

Ingredient ID: NPC150540

Ingredient ID: NPC148693

Ingredient ID: NPC14724

Ingredient ID: NPC141645

Ingredient ID: NPC138487

Ingredient ID: NPC13755

Ingredient ID: NPC136014

Ingredient ID: NPC133671

Ingredient ID: NPC133485

Ingredient ID: NPC129276

Ingredient ID: NPC128296

Ingredient ID: NPC127143

Ingredient ID: NPC12673

Ingredient ID: NPC125732

Ingredient ID: NPC125731

Ingredient ID: NPC121400

Ingredient ID: NPC118633

Ingredient ID: NPC116551

Ingredient ID: NPC111132

Ingredient ID: NPC111131

Ingredient ID: NPC1075

Ingredient ID: NPC102449

Ingredient ID: NPC101638

Ingredient ID: NPC100079