• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Pterocarpus Officinalis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

AATCGTTGCCCCAACCAACCCCAGCGCCTCCGGGCGCGAGAGGGGAGGGGCGAATGATGGCCTCCCGCGAGCGAGCGCGTCGCGGTTGGCCGAAAATCGGGCCCGTGGCGGAGCGTRGCGCCACGACAGACGGTGGTTGAGTGCAATCTCGAGGCCGGTCGTGCGCGCGCGTCCCTCCGCCGGTTACGGACCCTGCGGCCCGTGAGCGGCGCTGATCGCCCTTTGATGCGACCTCAGGTCAGGCGG
Taxonomic Information

Plant ID: NPO11452
Plant Latin Name: Pterocarpus Officinalis
Taxonomy Genus: Pterocarpus
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 330896
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

33 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


21 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

22 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95090

Ingredient ID: NPC81010

Ingredient ID: NPC62536

Ingredient ID: NPC55900

Ingredient ID: NPC52005

Ingredient ID: NPC50898

Ingredient ID: NPC49188

Ingredient ID: NPC42346

Ingredient ID: NPC40249

Ingredient ID: NPC37331

Ingredient ID: NPC37250

Ingredient ID: NPC294902

Ingredient ID: NPC294852

Ingredient ID: NPC284552

Ingredient ID: NPC279121

Ingredient ID: NPC278102

Ingredient ID: NPC260976

Ingredient ID: NPC231772

Ingredient ID: NPC226250

Ingredient ID: NPC220169

Ingredient ID: NPC21841

Ingredient ID: NPC213262

Ingredient ID: NPC2003

Ingredient ID: NPC192831

Ingredient ID: NPC189142

Ingredient ID: NPC170035

Ingredient ID: NPC1587

Ingredient ID: NPC157378

Ingredient ID: NPC156654

Ingredient ID: NPC143329

Ingredient ID: NPC141777

Ingredient ID: NPC129088

Ingredient ID: NPC100887