• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Gynochthodes Parvifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCCCGACGGACGACCGCGAACACGTTGAACAACCGCCGGGCGCCGGCGGGCGCGGGAAACCCCGCCCGTCGGCTGCCCGAGCCCAACTTAACTCCCGGCGCGGAATGCGCCAAGGAATACTCAAACGGATGGCCGGCCGCCCTGCGGCTTCCGCGGGGCGAGCCGAGCGTCTGATCGTTTAACCAAAACGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCGCCCCCTCCTCGCCCTAGAAATTGGGCCGGACGGGGGTGACGGAAGTTGGCCTCCCGTGCCCTCGCGGCGCGGCCGGCCTAAACGCGAGTCCCCGGCCCGGGACGTCACGACGAGTGGTGGTTGAACCCTTCAACTCGAGAGCCGTCGAGACGACGCCCGACGGGGAACTCCAACGACCCTAGGGCTATCGGCCCCTCTCCGAGAGGAGCCGCGAGCCTTCGA

Click for details-----ITS1

TCGAATCCTGCCCGACGGACGACCGCGAACACGTTGAACAACCGCCGGGCGCCGGCGGGCGCGGGAAACCCCGCCCGTCGGCTGCCCGAGCCCAACTTAACTCCCGGCGCGGAATGCGCCAAGGAATACTCAAACGGATGGCCGGCCGCCCTGCGGCTTCCGCGGGGCGAGCCGAGCGTCTGATCGTTTAACCAAAA

Click for details-----ITS2

ATCGCGTCGCCGCCCCCTCCTCGCCCTAGAAATTGGGCCGGACGGGGGTGACGGAAGTTGGCCTCCCGTGCCCTCGCGGCGCGGCCGGCCTAAACGCGAGTCCCCGGCCCGGGACGTCACGACGAGTGGTGGTTGAACCCTTCAACTCGAGAGCCGTCGAGACGACGCCCGACGGGGAACTCCAACGACCCTAGGGCTATCGGCCCCTCTCCGAGAGGAGCCGCGAGCCTTCGA
Taxonomic Information

Plant ID: NPO11242
Plant Latin Name: Gynochthodes Parvifolia
Taxonomy Genus: Gynochthodes
Taxonomy Family: Rubiaceae

Plant External Links:

NCBI TaxonomyDB: 266089
Plant-of-the-World-Online: 77117594-1

Used in Medicines

Country/Region:
Vietnam; Laos

Traditional Medicine System:

Geographical Distribution

Philippines; Vietnam; China; Taiwan; Laos

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

76 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


57 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

31 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC80370

Ingredient ID: NPC77289

Ingredient ID: NPC74576

Ingredient ID: NPC69029

Ingredient ID: NPC67813

Ingredient ID: NPC60762

Ingredient ID: NPC57490

Ingredient ID: NPC52220

Ingredient ID: NPC50146

Ingredient ID: NPC44816

Ingredient ID: NPC42253

Ingredient ID: NPC33998

Ingredient ID: NPC31799

Ingredient ID: NPC313000

Ingredient ID: NPC303560

Ingredient ID: NPC29826

Ingredient ID: NPC297948

Ingredient ID: NPC297685

Ingredient ID: NPC292828

Ingredient ID: NPC292237

Ingredient ID: NPC289185

Ingredient ID: NPC285812

Ingredient ID: NPC284607

Ingredient ID: NPC284296

Ingredient ID: NPC284265

Ingredient ID: NPC282496

Ingredient ID: NPC280766

Ingredient ID: NPC277772

Ingredient ID: NPC273109

Ingredient ID: NPC266453

Ingredient ID: NPC265151

Ingredient ID: NPC262701

Ingredient ID: NPC261181

Ingredient ID: NPC255643

Ingredient ID: NPC254625

Ingredient ID: NPC254122

Ingredient ID: NPC251855

Ingredient ID: NPC245358

Ingredient ID: NPC243728

Ingredient ID: NPC230301

Ingredient ID: NPC228503

Ingredient ID: NPC227376

Ingredient ID: NPC22610

Ingredient ID: NPC225781

Ingredient ID: NPC221077

Ingredient ID: NPC217786

Ingredient ID: NPC216624

Ingredient ID: NPC209785

Ingredient ID: NPC200696

Ingredient ID: NPC200557

Ingredient ID: NPC197908

Ingredient ID: NPC196673

Ingredient ID: NPC193544

Ingredient ID: NPC175838

Ingredient ID: NPC171886

Ingredient ID: NPC169782

Ingredient ID: NPC164749

Ingredient ID: NPC161576

Ingredient ID: NPC160697

Ingredient ID: NPC156654

Ingredient ID: NPC151656

Ingredient ID: NPC149290

Ingredient ID: NPC142956

Ingredient ID: NPC142047

Ingredient ID: NPC141765

Ingredient ID: NPC138248

Ingredient ID: NPC130449

Ingredient ID: NPC127582

Ingredient ID: NPC117214

Ingredient ID: NPC116907

Ingredient ID: NPC112778

Ingredient ID: NPC109192

Ingredient ID: NPC108936

Ingredient ID: NPC108198

Ingredient ID: NPC10426

Ingredient ID: NPC103180