• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rubus Alceifolius


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAAACCTGCCCAGCAGAACGACCCGAGAACATGTTTCAACGCTTGGGGGCGAAGGGTCCTACGGCTCCTCGTCCCTTTTCTCGAGAGGCAATCGTCTTGTGTCTTGCATCTCGATGCTCGCACTAGAAAGACCCTCTCGGGCGTACAAACGAACACCGGCGTGTATTGCGCCAAGGAACTTGAATGAAAGAGCGTTCCCCCGCCGTCYCGGAAACGGTGTGCGTGCGGTTGGTTACGTCATCTTCAATATGTCTAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO11222
Plant Latin Name: Rubus Alceifolius
Taxonomy Genus: Rubus
Taxonomy Family: Rosaceae

Plant External Links:

NCBI TaxonomyDB: 124693
Plant-of-the-World-Online: 106335-3

Used in Medicines

Unknown.

Geographical Distribution

Myanmar; Indonesia; Mauritius; Vietnam; China; Laos; Thailand; Taiwan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

25 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


16 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

11 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC71074

Ingredient ID: NPC70622

Ingredient ID: NPC3224

Ingredient ID: NPC312929

Ingredient ID: NPC301583

Ingredient ID: NPC277400

Ingredient ID: NPC275463

Ingredient ID: NPC271586

Ingredient ID: NPC271138

Ingredient ID: NPC266573

Ingredient ID: NPC263334

Ingredient ID: NPC255463

Ingredient ID: NPC254848

Ingredient ID: NPC250288

Ingredient ID: NPC2421

Ingredient ID: NPC241536

Ingredient ID: NPC225240

Ingredient ID: NPC188203

Ingredient ID: NPC158371

Ingredient ID: NPC147066

Ingredient ID: NPC142753

Ingredient ID: NPC131002

Ingredient ID: NPC125935

Ingredient ID: NPC110396

Ingredient ID: NPC104222